ID: 1067666797

View in Genome Browser
Species Human (GRCh38)
Location 10:48286006-48286028
Sequence CTTGTTCAGGACCTATCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067666790_1067666797 10 Left 1067666790 10:48285973-48285995 CCTTCGAAAACCAAAGGCAGATC No data
Right 1067666797 10:48286006-48286028 CTTGTTCAGGACCTATCTGTGGG No data
1067666791_1067666797 0 Left 1067666791 10:48285983-48286005 CCAAAGGCAGATCGTGCAATCCC No data
Right 1067666797 10:48286006-48286028 CTTGTTCAGGACCTATCTGTGGG No data
1067666788_1067666797 30 Left 1067666788 10:48285953-48285975 CCACTCAGCAGTCAAGCTGTCCT No data
Right 1067666797 10:48286006-48286028 CTTGTTCAGGACCTATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067666797 Original CRISPR CTTGTTCAGGACCTATCTGT GGG Intergenic
No off target data available for this crispr