ID: 1067667036

View in Genome Browser
Species Human (GRCh38)
Location 10:48287744-48287766
Sequence CAGATTTGAAACCTGGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067667036_1067667049 27 Left 1067667036 10:48287744-48287766 CCCGCTCCCAGGTTTCAAATCTG No data
Right 1067667049 10:48287794-48287816 AAAAAGGCTGAGCAGAAAGGAGG No data
1067667036_1067667046 11 Left 1067667036 10:48287744-48287766 CCCGCTCCCAGGTTTCAAATCTG No data
Right 1067667046 10:48287778-48287800 GCCTGGGTAGTTATTGAAAAAGG No data
1067667036_1067667048 24 Left 1067667036 10:48287744-48287766 CCCGCTCCCAGGTTTCAAATCTG No data
Right 1067667048 10:48287791-48287813 TTGAAAAAGGCTGAGCAGAAAGG No data
1067667036_1067667044 -6 Left 1067667036 10:48287744-48287766 CCCGCTCCCAGGTTTCAAATCTG No data
Right 1067667044 10:48287761-48287783 AATCTGGGGCAGATGGTGCCTGG No data
1067667036_1067667045 -5 Left 1067667036 10:48287744-48287766 CCCGCTCCCAGGTTTCAAATCTG No data
Right 1067667045 10:48287762-48287784 ATCTGGGGCAGATGGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067667036 Original CRISPR CAGATTTGAAACCTGGGAGC GGG (reversed) Intergenic