ID: 1067667037

View in Genome Browser
Species Human (GRCh38)
Location 10:48287745-48287767
Sequence CCAGATTTGAAACCTGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067667037_1067667046 10 Left 1067667037 10:48287745-48287767 CCGCTCCCAGGTTTCAAATCTGG No data
Right 1067667046 10:48287778-48287800 GCCTGGGTAGTTATTGAAAAAGG No data
1067667037_1067667045 -6 Left 1067667037 10:48287745-48287767 CCGCTCCCAGGTTTCAAATCTGG No data
Right 1067667045 10:48287762-48287784 ATCTGGGGCAGATGGTGCCTGGG No data
1067667037_1067667048 23 Left 1067667037 10:48287745-48287767 CCGCTCCCAGGTTTCAAATCTGG No data
Right 1067667048 10:48287791-48287813 TTGAAAAAGGCTGAGCAGAAAGG No data
1067667037_1067667049 26 Left 1067667037 10:48287745-48287767 CCGCTCCCAGGTTTCAAATCTGG No data
Right 1067667049 10:48287794-48287816 AAAAAGGCTGAGCAGAAAGGAGG No data
1067667037_1067667044 -7 Left 1067667037 10:48287745-48287767 CCGCTCCCAGGTTTCAAATCTGG No data
Right 1067667044 10:48287761-48287783 AATCTGGGGCAGATGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067667037 Original CRISPR CCAGATTTGAAACCTGGGAG CGG (reversed) Intergenic