ID: 1067667041

View in Genome Browser
Species Human (GRCh38)
Location 10:48287750-48287772
Sequence CTGCCCCAGATTTGAAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067667041_1067667049 21 Left 1067667041 10:48287750-48287772 CCCAGGTTTCAAATCTGGGGCAG No data
Right 1067667049 10:48287794-48287816 AAAAAGGCTGAGCAGAAAGGAGG No data
1067667041_1067667048 18 Left 1067667041 10:48287750-48287772 CCCAGGTTTCAAATCTGGGGCAG No data
Right 1067667048 10:48287791-48287813 TTGAAAAAGGCTGAGCAGAAAGG No data
1067667041_1067667046 5 Left 1067667041 10:48287750-48287772 CCCAGGTTTCAAATCTGGGGCAG No data
Right 1067667046 10:48287778-48287800 GCCTGGGTAGTTATTGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067667041 Original CRISPR CTGCCCCAGATTTGAAACCT GGG (reversed) Intergenic