ID: 1067667042

View in Genome Browser
Species Human (GRCh38)
Location 10:48287751-48287773
Sequence TCTGCCCCAGATTTGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067667042_1067667048 17 Left 1067667042 10:48287751-48287773 CCAGGTTTCAAATCTGGGGCAGA No data
Right 1067667048 10:48287791-48287813 TTGAAAAAGGCTGAGCAGAAAGG No data
1067667042_1067667046 4 Left 1067667042 10:48287751-48287773 CCAGGTTTCAAATCTGGGGCAGA No data
Right 1067667046 10:48287778-48287800 GCCTGGGTAGTTATTGAAAAAGG No data
1067667042_1067667049 20 Left 1067667042 10:48287751-48287773 CCAGGTTTCAAATCTGGGGCAGA No data
Right 1067667049 10:48287794-48287816 AAAAAGGCTGAGCAGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067667042 Original CRISPR TCTGCCCCAGATTTGAAACC TGG (reversed) Intergenic