ID: 1067667046

View in Genome Browser
Species Human (GRCh38)
Location 10:48287778-48287800
Sequence GCCTGGGTAGTTATTGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067667037_1067667046 10 Left 1067667037 10:48287745-48287767 CCGCTCCCAGGTTTCAAATCTGG No data
Right 1067667046 10:48287778-48287800 GCCTGGGTAGTTATTGAAAAAGG No data
1067667041_1067667046 5 Left 1067667041 10:48287750-48287772 CCCAGGTTTCAAATCTGGGGCAG No data
Right 1067667046 10:48287778-48287800 GCCTGGGTAGTTATTGAAAAAGG No data
1067667036_1067667046 11 Left 1067667036 10:48287744-48287766 CCCGCTCCCAGGTTTCAAATCTG No data
Right 1067667046 10:48287778-48287800 GCCTGGGTAGTTATTGAAAAAGG No data
1067667042_1067667046 4 Left 1067667042 10:48287751-48287773 CCAGGTTTCAAATCTGGGGCAGA No data
Right 1067667046 10:48287778-48287800 GCCTGGGTAGTTATTGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067667046 Original CRISPR GCCTGGGTAGTTATTGAAAA AGG Intergenic