ID: 1067678282

View in Genome Browser
Species Human (GRCh38)
Location 10:48406354-48406376
Sequence AGGCAACACCACCACTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067678282_1067678285 -7 Left 1067678282 10:48406354-48406376 CCATGGCAGTGGTGGTGTTGCCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1067678285 10:48406370-48406392 GTTGCCTTAGTTTTTCCTTGGGG No data
1067678282_1067678284 -8 Left 1067678282 10:48406354-48406376 CCATGGCAGTGGTGGTGTTGCCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1067678284 10:48406369-48406391 TGTTGCCTTAGTTTTTCCTTGGG No data
1067678282_1067678283 -9 Left 1067678282 10:48406354-48406376 CCATGGCAGTGGTGGTGTTGCCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1067678283 10:48406368-48406390 GTGTTGCCTTAGTTTTTCCTTGG No data
1067678282_1067678286 -4 Left 1067678282 10:48406354-48406376 CCATGGCAGTGGTGGTGTTGCCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1067678286 10:48406373-48406395 GCCTTAGTTTTTCCTTGGGGAGG No data
1067678282_1067678290 27 Left 1067678282 10:48406354-48406376 CCATGGCAGTGGTGGTGTTGCCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1067678290 10:48406404-48406426 TAATCCTACCTCTCAAGCCTGGG No data
1067678282_1067678289 26 Left 1067678282 10:48406354-48406376 CCATGGCAGTGGTGGTGTTGCCT 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1067678289 10:48406403-48406425 TTAATCCTACCTCTCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067678282 Original CRISPR AGGCAACACCACCACTGCCA TGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901663337 1:10812799-10812821 AGGCAGACCCACCACGGCCATGG + Intergenic
903764788 1:25727322-25727344 AGGAAATACCACCAGTGCCCTGG - Intronic
905861844 1:41357401-41357423 AGGCTGTACCACCACTGGCAGGG - Intergenic
905874276 1:41422349-41422371 AGCCAACCCCACCCATGCCATGG - Intergenic
906011008 1:42526175-42526197 AGGTGACACTACAACTGCCAGGG - Intronic
906526828 1:46498288-46498310 AGGCAGGACCACCACAGCCCAGG - Intergenic
907656150 1:56343366-56343388 AGGCAGCACCACCAAAGCCCAGG + Intergenic
908267999 1:62397221-62397243 AGGCTATCCCAGCACTGCCAAGG + Intergenic
909852640 1:80487662-80487684 AGGAAGCACAATCACTGCCAGGG + Intergenic
910523318 1:88148617-88148639 AGGCAATACCACCTCTGAGAGGG - Intergenic
911948944 1:104147647-104147669 AGGCACAAACACCAGTGCCAAGG + Intergenic
917977435 1:180249382-180249404 AGGCACCAACATCACTGCCTTGG - Intronic
919757194 1:201073548-201073570 GGGCATCCCCACCACTGCCAAGG - Exonic
923030358 1:230244545-230244567 AGTCAAAACCAAAACTGCCATGG + Intronic
924037640 1:239953375-239953397 AGGCCACTTCACCACAGCCAGGG + Intergenic
1062829580 10:596817-596839 TGTCATCACCACCACTGCCCAGG + Intronic
1063242295 10:4183516-4183538 AGGAGAAACCACCACTACCACGG - Intergenic
1063511006 10:6645620-6645642 CGGCAACACCACCAGCACCATGG - Intergenic
1063997912 10:11638367-11638389 TGCCACCACCACCACTGCCCCGG + Intergenic
1065060058 10:21890700-21890722 AGGCAGCACTACCCCTTCCATGG + Intronic
1067678282 10:48406354-48406376 AGGCAACACCACCACTGCCATGG - Intronic
1067922262 10:50471434-50471456 AACCAACACAACCACTTCCATGG + Intronic
1068433658 10:56963601-56963623 AGGCACCAGCACCAGTGCCAAGG - Intergenic
1069182064 10:65374027-65374049 AGGTAAGACAACCACTGTCATGG + Intergenic
1069738921 10:70675091-70675113 AGGCAGCACCACCCCTGCCTTGG - Intronic
1070923308 10:80202653-80202675 ATGCTTCACCAGCACTGCCAAGG - Intronic
1072441476 10:95459899-95459921 AGGCAACCCCAACGCTGCAAAGG - Intronic
1074987943 10:118673906-118673928 TGGCTTCACCACCACTGCCGGGG + Intergenic
1075520667 10:123141911-123141933 TGGCATCACCACCATTGCTAAGG + Intergenic
1077917874 11:6622823-6622845 AAGCACCACCACAACTCCCAAGG + Exonic
1078604732 11:12765117-12765139 AGGAAACACCAAGAGTGCCAAGG + Intronic
1080930804 11:36808059-36808081 AGGCAACAGCACTACTGTCTTGG - Intergenic
1083339528 11:61950115-61950137 GGGCAACACCCCCTCTACCATGG - Intronic
1083594618 11:63913031-63913053 AGACACCAGCACCACTGCCCCGG + Intronic
1086061324 11:82702570-82702592 CTGCAACACCACCTCTGCTAGGG + Intergenic
1090306899 11:125699067-125699089 AGGGCAAACCACCACTGCCAAGG - Intergenic
1090630076 11:128638057-128638079 AGGCATAAGCACCAGTGCCAAGG - Intergenic
1091206011 11:133821679-133821701 ATGCAGCAGCCCCACTGCCAGGG + Intergenic
1093709310 12:22311849-22311871 AGGCAAGACCTCCATTGCAAAGG + Intronic
1097035634 12:56121792-56121814 GAGCCACACCACCACTCCCATGG + Exonic
1098193655 12:67977041-67977063 AGCCAACACCACCAGGGCCCTGG - Intergenic
1100615424 12:96227781-96227803 AGGCAACACGGCCACAGTCATGG - Intronic
1101788492 12:107907510-107907532 GGCCACCACCACCACTACCAAGG + Intergenic
1103347354 12:120260066-120260088 AGCTTACAGCACCACTGCCAAGG - Intronic
1104227761 12:126852521-126852543 AGGCAAGCCCAGGACTGCCAGGG + Intergenic
1107310691 13:39073978-39074000 AGGCAACACCACCAAAGTCCAGG + Intergenic
1108372649 13:49786136-49786158 AGGCAACAGTATCAATGCCATGG + Intronic
1109581039 13:64334497-64334519 AGCCACCACCACCTCTGCCTGGG - Intergenic
1113786442 13:113004370-113004392 AGCCAACACCACCTCCTCCATGG + Intronic
1114403426 14:22431370-22431392 AGGCAAGACCATCACTGGGAGGG + Intergenic
1119427644 14:74546227-74546249 AGGCAAAGCCACTAGTGCCAGGG + Intronic
1122968342 14:105142278-105142300 GGGCCACACCAACACAGCCATGG + Exonic
1124011880 15:25845542-25845564 AGGCAACAAGACCACAGACAGGG + Intronic
1125155931 15:36585541-36585563 AGGCCACACCATCACTTCCAGGG - Intronic
1125512320 15:40298732-40298754 AGGCTACAACCCCGCTGCCAAGG + Intronic
1128261566 15:66236542-66236564 ATTCAATACCACCAATGCCATGG + Intronic
1129465462 15:75722105-75722127 AGGGACCACCACCAATGCCCTGG - Intergenic
1131642961 15:94312489-94312511 AGGAAGTACCACCACTGCCTAGG - Intronic
1132474874 16:129694-129716 AGGCAGCACCACACCTGCCATGG - Intronic
1135023082 16:18978811-18978833 CAGCACCACCACCCCTGCCAAGG - Intergenic
1136042537 16:27591757-27591779 TGCCAAAACCACCACTACCATGG - Intronic
1136265113 16:29111631-29111653 GGGCACCAACACCACAGCCAAGG - Intergenic
1137598900 16:49743108-49743130 AGACAACACCTCCACACCCAGGG + Intronic
1138664795 16:58556828-58556850 AGACAACACTACCACTTACAAGG + Exonic
1140448989 16:75054808-75054830 AGGCCAAAGCACCATTGCCATGG - Intronic
1140906495 16:79413786-79413808 AGGCAACCCCTACTCTGCCAGGG + Intergenic
1141706678 16:85669039-85669061 AGGCCACATCTCCCCTGCCAGGG + Intronic
1141872048 16:86793809-86793831 GGGGAACATCTCCACTGCCAGGG - Intergenic
1142163986 16:88575503-88575525 TTGCCACACCACCACTACCAGGG - Intronic
1142354357 16:89595323-89595345 CAGCAACACCACACCTGCCATGG - Intronic
1142850654 17:2703241-2703263 AGGCAGCACCATCCATGCCAGGG - Intronic
1143496130 17:7313640-7313662 AGGCACCACCAGGACTGCCTTGG + Exonic
1144761627 17:17710600-17710622 AGGCCAAGCCACCAGTGCCAGGG - Intronic
1144968672 17:19093655-19093677 GGGCATCCCCTCCACTGCCAGGG - Exonic
1144979243 17:19158411-19158433 GGGCATCCCCTCCACTGCCAGGG + Exonic
1144988979 17:19219821-19219843 GGGCATCCCCTCCACTGCCAGGG - Exonic
1148154542 17:45415359-45415381 AGGCTCCACCTCCTCTGCCACGG + Intronic
1153610584 18:6880365-6880387 AAGCCACAGCACCACTTCCAGGG - Intronic
1154208046 18:12354612-12354634 TGACAAGACCAGCACTGCCAAGG + Intronic
1154224748 18:12493160-12493182 AACCAACTCCACCACGGCCACGG - Exonic
1155591160 18:27428830-27428852 AGGCAACACCCCAATTCCCAGGG + Intergenic
1155663758 18:28282386-28282408 AGGCACAAGCACCAATGCCAAGG - Intergenic
1155884810 18:31195094-31195116 AAGGGACACCAACACTGCCAGGG + Intergenic
1157180296 18:45491868-45491890 AGCCAGCACCAGCTCTGCCAGGG + Intronic
1157687825 18:49657037-49657059 AGGAAAAGCCACCTCTGCCAAGG + Intergenic
1158705454 18:59788531-59788553 GAGCATCCCCACCACTGCCACGG + Intergenic
1159365763 18:67464239-67464261 AGGCACAAACACTACTGCCAAGG + Intergenic
1160266302 18:77342859-77342881 AACCAACACCAGCGCTGCCAGGG + Intergenic
1161950481 19:7464992-7465014 AGGCACCACCACACCTGCCCCGG - Intronic
1162497289 19:11030392-11030414 AGCCACCACCACCACAGCCCTGG - Intronic
1163445135 19:17341521-17341543 AGGCACCAGCACCACCTCCAGGG + Exonic
1163936424 19:20448757-20448779 AAGCAACATCAGCACTGACAGGG + Intergenic
1163984373 19:20931187-20931209 AAGCAACATCAGCACTGACAGGG + Intronic
1165596568 19:37014728-37014750 AGGGACCACCACCATTGCCTGGG + Intronic
1166476045 19:43125551-43125573 AGGCCACACATCCACTGCAATGG + Intronic
1166558510 19:43717110-43717132 ATGAAACCCCACCCCTGCCATGG - Intronic
1167407228 19:49320059-49320081 AGGCAACAAAAGCAATGCCAAGG + Intronic
1167592765 19:50413500-50413522 TGGCTACAGCACCAGTGCCAAGG + Exonic
1168292321 19:55362640-55362662 AGGCAACACCAGGCCTGGCAGGG + Exonic
925126807 2:1463080-1463102 AGGCAAGACCACATCTGGCAGGG + Intronic
926977912 2:18533459-18533481 AGGGAACACCACCATTTCCCTGG + Intergenic
929245849 2:39702629-39702651 AGACCTCACAACCACTGCCATGG + Intronic
931893993 2:66708536-66708558 AGGCTAGACCACCACAGCCTAGG - Intergenic
932053774 2:68424453-68424475 AGGCAAGATCACCACTGTTATGG + Intergenic
932277238 2:70460752-70460774 TGGCACCATCACCACAGCCAAGG - Intronic
932663846 2:73680447-73680469 AGGAAACTCCACCACCACCAAGG + Intergenic
934567120 2:95347048-95347070 CAGCAGCACCACCACGGCCATGG - Intronic
936166897 2:110128633-110128655 AGGTAACATCACAAGTGCCATGG - Intronic
936451974 2:112640584-112640606 AGTCCACTCCACCACTGCCGAGG - Intergenic
937241802 2:120466629-120466651 AGGCAAAGCCAGCTCTGCCAGGG - Intergenic
940089216 2:149897225-149897247 AGGCAGCACCTCCTCTGCCCAGG + Intergenic
940657272 2:156503098-156503120 TGGCACCAGCACCACAGCCAAGG - Intronic
941205203 2:162563442-162563464 AAGCAAAACCACCACTGAGAAGG - Intronic
943067743 2:183106302-183106324 AGGTGACACGGCCACTGCCAAGG + Intergenic
944321586 2:198350633-198350655 AGGCAACACCACCATTACAAAGG + Intronic
944990478 2:205229918-205229940 AGCCACCACCACCACGTCCATGG + Intronic
945265513 2:207887781-207887803 AGAGAACAACAGCACTGCCAGGG + Intronic
946002572 2:216495073-216495095 AGCCAACACGACCTCAGCCAAGG - Intergenic
946247343 2:218395233-218395255 AGACACCACCACCCTTGCCATGG + Exonic
947075897 2:226345475-226345497 TAGCAACTTCACCACTGCCAAGG - Intergenic
947311620 2:228809447-228809469 AGCCAACACCACCAGGGCCCTGG - Intergenic
947732697 2:232439914-232439936 GGGCGTCACCACCACAGCCAGGG + Intergenic
948950980 2:241251433-241251455 AGGCCACAGCACAGCTGCCAAGG + Intronic
1170112595 20:12821937-12821959 AGGCATCACCCACAGTGCCAGGG - Intergenic
1172411095 20:34723637-34723659 TTCCAACATCACCACTGCCACGG + Intronic
1173331177 20:42077529-42077551 AGCCAACACCACCACCCCCAGGG - Exonic
1173760908 20:45559676-45559698 AAGCAACGCCACATCTGCCAAGG - Intronic
1174163233 20:48566338-48566360 AGGCACCAGCACGAGTGCCAGGG - Intergenic
1175415462 20:58797726-58797748 AGGCAAACCCCTCACTGCCAGGG + Intergenic
1175927601 20:62478587-62478609 AGGAAACACCAACATTGCCCGGG + Intergenic
1179046729 21:37851181-37851203 AGGCAACCACACCACTTCCCTGG - Intronic
1179896313 21:44365606-44365628 ATTCAAACCCACCACTGCCACGG - Intronic
1180850348 22:19016104-19016126 AGGCTCCAACACCCCTGCCACGG - Intergenic
1180854509 22:19037727-19037749 AGGCAACAAAACCACTGCCCAGG + Exonic
1181902269 22:26166344-26166366 AGACCACAACATCACTGCCATGG + Intergenic
1183301268 22:37060299-37060321 ACCCACCCCCACCACTGCCAGGG + Intronic
1183559985 22:38564817-38564839 AGTCAATTCCACAACTGCCAGGG - Intronic
1185053368 22:48565194-48565216 AGGCAAGAACCCCACTGTCACGG + Intronic
952616343 3:35278161-35278183 AGCCAACACCACCAGGGCCTGGG + Intergenic
952667244 3:35922031-35922053 AGGCACAAGCACCAGTGCCAAGG + Intergenic
952759059 3:36897833-36897855 AGACTGCACCATCACTGCCAAGG + Intronic
953269186 3:41423894-41423916 AGCCAACACCACCAGGGCCTTGG + Intronic
953568280 3:44051572-44051594 TGGCAGCAGCACCAGTGCCAGGG - Intergenic
953876701 3:46670777-46670799 AGGGAAAACCACCACATCCAGGG + Exonic
954366291 3:50147924-50147946 AGGCCACGCCACCGCTGTCATGG + Intergenic
958595367 3:96215864-96215886 AGGCACACCCACCAGTGCCATGG - Intergenic
959534564 3:107470385-107470407 AGCCTACACCACCAATGCCCTGG + Intergenic
961357695 3:126349430-126349452 GGGCAGCACGACCAGTGCCAGGG + Intronic
961761398 3:129171643-129171665 AGGTAAAACCACCTCTGCCACGG + Exonic
961917380 3:130391426-130391448 AGGGAACACCTACACTGCCAAGG + Exonic
965147698 3:164927778-164927800 AAGCACTGCCACCACTGCCAGGG - Intergenic
967245241 3:187480055-187480077 AGTCAACATCACCATTGCCTGGG - Intergenic
968437303 4:600412-600434 AGGCCCCACCACCAGTGCCTTGG - Intergenic
968872014 4:3247023-3247045 GGACACCACCACCACTGCCGGGG - Intronic
969301916 4:6302027-6302049 TGGCAACACCTCCACGGCCGAGG + Exonic
973001802 4:44961243-44961265 AGCCACAAACACCACTGCCAAGG + Intergenic
975443502 4:74438150-74438172 AGCCAACACCTCCAGTGCCAAGG + Intergenic
975996777 4:80324590-80324612 TGGCAGCAACACCACTGCCATGG - Intronic
980143169 4:128946849-128946871 AGGTACAACCACCACTGCCGAGG - Intronic
985634686 5:1030210-1030232 AGCCAAGACCACCAATGCCCAGG - Intronic
986374193 5:7113662-7113684 AGGATTCACCTCCACTGCCAGGG - Intergenic
987034426 5:14005911-14005933 AGGCAAAACCACCAGGGACAAGG + Intergenic
989176624 5:38533835-38533857 AGGCAACACCTGCACAGTCAGGG + Intronic
989368635 5:40681949-40681971 AGGCGACACGTTCACTGCCAAGG - Intronic
998228046 5:140341939-140341961 AGGCAACATCACCCCTTCCCTGG - Intronic
999228878 5:150049747-150049769 AGTAAACACCTCCACTGACAGGG - Intronic
1000245698 5:159446935-159446957 CTCCAACACCACCACAGCCAAGG + Intergenic
1000642403 5:163718387-163718409 AGGAGACCCCACCACTCCCATGG + Intergenic
1001032758 5:168274906-168274928 AGGCAAGCCCATCCCTGCCAGGG + Intergenic
1001517773 5:172367858-172367880 ATGCAACACCAGCATTCCCAAGG - Intronic
1004970869 6:20908868-20908890 AAGCAAAACCACCACTTTCATGG - Intronic
1006668634 6:35715926-35715948 AGGCCTCACCACCACTGCCTTGG - Intronic
1007247248 6:40471474-40471496 ATGCCACACCACCTCTCCCAGGG - Intronic
1007896720 6:45369638-45369660 AGCCAACACCACCAGTGCTTTGG + Intronic
1016175569 6:141074597-141074619 AGGCACAAGCACCAGTGCCAAGG + Intergenic
1016466867 6:144334416-144334438 ACGCAACACTACCACTCCCGGGG - Intronic
1016982115 6:149863577-149863599 GGGCAGCTCCACCACGGCCACGG + Exonic
1017592614 6:155993486-155993508 AGGCAAACCCACCACAGCCATGG + Intergenic
1018376534 6:163218576-163218598 TGGCAACACCAAGGCTGCCAGGG - Intronic
1020715742 7:11673513-11673535 AGGCCCCATCACCATTGCCATGG + Intronic
1023781385 7:43659099-43659121 AGCCACCACCAGCTCTGCCATGG - Intronic
1024324641 7:48099518-48099540 AGACAACCCCAACATTGCCAAGG - Intronic
1028292286 7:89080145-89080167 TGTCACCACCACCACTGCCCTGG - Intronic
1032422592 7:131794764-131794786 ATCCAACACCAGCACTTCCATGG - Intergenic
1035601647 8:900467-900489 CGGCAAGACCACCACCTCCAAGG - Intergenic
1035889709 8:3330047-3330069 GGGCCACACCATGACTGCCATGG - Intronic
1036538674 8:9679774-9679796 AGGCAGCATCACCAGTGCCTTGG - Intronic
1037987300 8:23297991-23298013 AGGCCACACCACATCTTCCATGG - Exonic
1040814301 8:51491588-51491610 AAACCCCACCACCACTGCCATGG + Intronic
1044118479 8:88364628-88364650 AGGCTACAGCACCAGGGCCAAGG + Intergenic
1044664683 8:94623094-94623116 AGGCACCACCACGCCTGCCTGGG - Intergenic
1044955624 8:97476551-97476573 AGGCACAAGCACCAGTGCCAAGG - Intergenic
1045087548 8:98702788-98702810 AGGCAATACCACCAGTGGCTGGG + Intronic
1045111142 8:98940399-98940421 AGGCTAGACCACCACGGCCACGG + Intronic
1046763965 8:118049836-118049858 AGGCAGCCCCACGACCGCCAGGG + Intronic
1048710205 8:137201432-137201454 AAGCCACCCCACCACTCCCATGG + Intergenic
1049392497 8:142379488-142379510 GGCCAACACCACTCCTGCCAGGG + Intronic
1049598618 8:143496809-143496831 AGGCCACACCAGTGCTGCCATGG + Intronic
1049600897 8:143507071-143507093 GGGCACCACCACCACAGCAAAGG + Intronic
1050176657 9:2875864-2875886 AGGCACCACCAGGACTGCCTTGG + Intergenic
1051575653 9:18612394-18612416 AGGCAACACCACAAGTGACAGGG - Intronic
1052848243 9:33357031-33357053 AGGCACCACCATTACGGCCATGG - Intronic
1053664444 9:40307761-40307783 AGGCAACTTCACTACTTCCAAGG - Intronic
1054520170 9:66068523-66068545 AGGCAACTTCACTACTTCCAAGG + Intergenic
1056326945 9:85487995-85488017 AGGAACCAGCAGCACTGCCAGGG + Intergenic
1060197816 9:121634722-121634744 AGGCTAGACCACCAGGGCCAGGG - Intronic
1060224252 9:121781746-121781768 AGGCAGCTCCTCCCCTGCCAGGG + Intronic
1061202454 9:129145756-129145778 AGGCAGCACCCACACAGCCATGG - Intronic
1061444714 9:130631319-130631341 TGGCACCACCACAACTGCCCTGG - Intronic
1061914304 9:133741306-133741328 AGCCAACATCACCACTGACCAGG + Intergenic
1061924561 9:133799581-133799603 AGGCATCACCATCATTGCAAAGG + Intronic
1062070036 9:134550398-134550420 AGGCACAGCCACCACTGCCAGGG - Intergenic
1062396257 9:136353994-136354016 AGGCAACACCCCCACTCCCCCGG - Intronic
1187605125 X:20874565-20874587 AGCCTACACCACCAGTGCCTTGG + Intergenic
1188712264 X:33415476-33415498 ATGCAACACCACCACTTCTGAGG - Intergenic
1189369354 X:40415684-40415706 AGGCAAAAGCAGCAGTGCCAAGG + Intergenic
1189478442 X:41375078-41375100 AGGCAACACCCCCAGTGCTTAGG + Intergenic
1190444365 X:50508371-50508393 ATCCCACACCACCCCTGCCAGGG + Intergenic
1191654775 X:63584891-63584913 AGGCAAGACCACCACTCTCAAGG + Intergenic
1192393202 X:70752855-70752877 TTGCACCACCGCCACTGCCAGGG - Intronic
1193393038 X:80951754-80951776 TGGAAGCACCACCACAGCCAAGG - Intergenic
1193779177 X:85682485-85682507 AGGCACAAGCACCAGTGCCAAGG + Intergenic
1194957524 X:100198153-100198175 AGGCAGGACCTCCACTGCAATGG + Intergenic
1198168152 X:134077781-134077803 AGGCAGCACCACCAAAGCCCGGG + Intergenic
1199227401 X:145394076-145394098 AGGCACGAGCACCAGTGCCATGG + Intergenic
1200691208 Y:6307249-6307271 AGGCAACACCACGACTGTGGTGG - Intergenic
1201044064 Y:9867467-9867489 AGGCAACACCACGACTGTGGTGG + Intergenic
1201602893 Y:15750152-15750174 AGGGAACACAACCTCTGACAAGG - Intergenic
1202369497 Y:24187349-24187371 AGGCCACATCACCACTGCTCTGG + Intergenic
1202501288 Y:25482768-25482790 AGGCCACATCACCACTGCTCTGG - Intergenic