ID: 1067680349

View in Genome Browser
Species Human (GRCh38)
Location 10:48432261-48432283
Sequence TAGCATCTTGTATATGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067680345_1067680349 21 Left 1067680345 10:48432217-48432239 CCTCAGAAACTTCTACTTTTGAG 0: 1
1: 0
2: 1
3: 88
4: 2102
Right 1067680349 10:48432261-48432283 TAGCATCTTGTATATGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067680349 Original CRISPR TAGCATCTTGTATATGGGTA AGG Intronic
No off target data available for this crispr