ID: 1067682177

View in Genome Browser
Species Human (GRCh38)
Location 10:48448202-48448224
Sequence CCCTGACTCTCCCCCACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067682168_1067682177 1 Left 1067682168 10:48448178-48448200 CCCCACACATCTCCAGTCCCCAG 0: 1
1: 0
2: 1
3: 34
4: 608
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682160_1067682177 18 Left 1067682160 10:48448161-48448183 CCCACCCATTGCCCCCTCCCCAC 0: 1
1: 1
2: 7
3: 211
4: 2707
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682166_1067682177 5 Left 1067682166 10:48448174-48448196 CCCTCCCCACACATCTCCAGTCC 0: 1
1: 0
2: 2
3: 50
4: 585
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682169_1067682177 0 Left 1067682169 10:48448179-48448201 CCCACACATCTCCAGTCCCCAGC No data
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682162_1067682177 14 Left 1067682162 10:48448165-48448187 CCCATTGCCCCCTCCCCACACAT 0: 1
1: 0
2: 4
3: 47
4: 468
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682163_1067682177 13 Left 1067682163 10:48448166-48448188 CCATTGCCCCCTCCCCACACATC No data
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682164_1067682177 7 Left 1067682164 10:48448172-48448194 CCCCCTCCCCACACATCTCCAGT No data
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682165_1067682177 6 Left 1067682165 10:48448173-48448195 CCCCTCCCCACACATCTCCAGTC 0: 1
1: 0
2: 3
3: 39
4: 578
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682161_1067682177 17 Left 1067682161 10:48448162-48448184 CCACCCATTGCCCCCTCCCCACA 0: 1
1: 0
2: 6
3: 183
4: 1773
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682167_1067682177 4 Left 1067682167 10:48448175-48448197 CCTCCCCACACATCTCCAGTCCC 0: 1
1: 0
2: 2
3: 64
4: 607
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682158_1067682177 27 Left 1067682158 10:48448152-48448174 CCAAAAGGCCCCACCCATTGCCC 0: 1
1: 0
2: 3
3: 28
4: 231
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682170_1067682177 -1 Left 1067682170 10:48448180-48448202 CCACACATCTCCAGTCCCCAGCC 0: 1
1: 0
2: 10
3: 58
4: 572
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data
1067682159_1067682177 19 Left 1067682159 10:48448160-48448182 CCCCACCCATTGCCCCCTCCCCA 0: 1
1: 0
2: 7
3: 118
4: 1208
Right 1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067682177 Original CRISPR CCCTGACTCTCCCCCACTAC AGG Intronic
No off target data available for this crispr