ID: 1067682487

View in Genome Browser
Species Human (GRCh38)
Location 10:48449780-48449802
Sequence GCTTGGTTCAGCAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067682480_1067682487 5 Left 1067682480 10:48449752-48449774 CCATCCTGTGACAAGGGCGGACA No data
Right 1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG No data
1067682481_1067682487 1 Left 1067682481 10:48449756-48449778 CCTGTGACAAGGGCGGACACGAG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG No data
1067682476_1067682487 23 Left 1067682476 10:48449734-48449756 CCTCAGGGTGCAGCACAACCATC 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067682487 Original CRISPR GCTTGGTTCAGCAGGGAAAC TGG Intronic
No off target data available for this crispr