ID: 1067682754

View in Genome Browser
Species Human (GRCh38)
Location 10:48450884-48450906
Sequence CCGGCTCCCCGGCCCCGTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067682742_1067682754 16 Left 1067682742 10:48450845-48450867 CCAACTGGGCAGGGTCTGCACCT 0: 1
1: 0
2: 2
3: 22
4: 183
Right 1067682754 10:48450884-48450906 CCGGCTCCCCGGCCCCGTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 198
1067682745_1067682754 -4 Left 1067682745 10:48450865-48450887 CCTTCTTCCCAGGGCTGCACCGG 0: 1
1: 0
2: 3
3: 28
4: 279
Right 1067682754 10:48450884-48450906 CCGGCTCCCCGGCCCCGTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067682754 Original CRISPR CCGGCTCCCCGGCCCCGTGG GGG Exonic
900109752 1:1000433-1000455 CCGGCTCCCGGCCCCCTGGGCGG - Intergenic
900633892 1:3652494-3652516 CGGGCTGCCCGGCCCCTAGGCGG - Intronic
901066651 1:6497469-6497491 CCCGCCCCCCGCCCCCGAGGCGG - Intronic
901169427 1:7245977-7245999 CAGGCTTCCCTGCCCGGTGGAGG - Intronic
901496867 1:9627288-9627310 CGGGCACCCGGGCTCCGTGGCGG + Intergenic
902385509 1:16073439-16073461 CCGGCCCCGCGGCCCCGTGATGG - Exonic
902808558 1:18875530-18875552 CCTGGTCCCTGGTCCCGTGGAGG - Intronic
904347044 1:29879360-29879382 CCCGCTCCCAGGCCCAGTGCCGG + Intergenic
905238740 1:36568303-36568325 CTGGCTCCCCAGCACCCTGGAGG - Intergenic
905644755 1:39617377-39617399 CCCGCTCCCCTTCCCCCTGGTGG + Intergenic
906140699 1:43531849-43531871 CCGGCTCCCCATCGCCGTGCCGG + Intronic
914022824 1:143885087-143885109 CCTGCTCCCGGGCCCCGGCGCGG + Intergenic
914661311 1:149793031-149793053 CCAGCTCCCGGGCCCCGGCGCGG + Intronic
914917154 1:151825893-151825915 CAGGCTCCCCCGCCCCCAGGTGG + Intronic
915246330 1:154558567-154558589 CCGGCCCGCCGGCCCCGGAGCGG - Exonic
915549749 1:156625156-156625178 CCGGCGACGCGGCGCCGTGGTGG + Exonic
919739198 1:200972315-200972337 GAGACTCCCCGGCCCAGTGGGGG + Intronic
919922001 1:202171601-202171623 CCGTCTCCCGGGCTCCTTGGAGG - Intergenic
922730394 1:227946378-227946400 CCTGCTCTCCGGCCCAGCGGAGG - Intronic
924362336 1:243254909-243254931 CCCGCACCCCCGCCCCGCGGCGG + Intronic
1062906612 10:1183837-1183859 CTGGCCTCCCTGCCCCGTGGTGG - Intronic
1063120838 10:3104805-3104827 CACACTCCCCGGCCCCGTGCTGG - Intronic
1065628601 10:27655174-27655196 CAGGCTCCCTGGCCCATTGGAGG + Intergenic
1067669694 10:48307222-48307244 CCGGCTCCCCGCCGCCCCGGAGG - Intronic
1067682754 10:48450884-48450906 CCGGCTCCCCGGCCCCGTGGGGG + Exonic
1068939676 10:62668661-62668683 CTGGCTCCCTCGCCCTGTGGTGG + Intronic
1073432251 10:103494140-103494162 CTGCCTCCCATGCCCCGTGGCGG - Exonic
1075617958 10:123905221-123905243 CCGGCTCCCAGGCTGTGTGGCGG - Intronic
1075778657 10:125003442-125003464 CCTGCACCCCCGCCCCCTGGTGG - Exonic
1077252973 11:1568760-1568782 CCGGCTCCCCGCCCCCTCAGAGG + Intronic
1077373748 11:2195608-2195630 CCCGCTTCCCGCCCCCGGGGAGG + Intergenic
1077540275 11:3143302-3143324 CCGGCTCCAGGGGCCCATGGGGG + Intronic
1077635828 11:3840901-3840923 CCAGCTCCCCCGCCTCGGGGAGG - Exonic
1078106656 11:8362035-8362057 CCAGCTCCTAGGCCCCATGGAGG - Intergenic
1079247240 11:18761621-18761643 CCAGCTCCCCGGTACTGTGGGGG - Intronic
1083186470 11:61020682-61020704 CCAGCTCCCTGCCCCCTTGGTGG - Intergenic
1083843138 11:65315745-65315767 CCGGCTCCGCGGCCGCCAGGTGG - Intronic
1084209447 11:67614337-67614359 CCGGGTGCCCCGCCCCCTGGTGG - Intergenic
1084524214 11:69685926-69685948 CCGAGTCCCCGGCCCCGCGCGGG + Intergenic
1084892922 11:72245209-72245231 CCCTCTCCGCAGCCCCGTGGAGG - Intronic
1090458445 11:126869264-126869286 CCGGCTTCCTTGCCCCTTGGTGG + Intronic
1096143942 12:49265026-49265048 CCCGGTCCCCGGCCACGTGTCGG - Exonic
1096204162 12:49707287-49707309 CCGACTCCTCGGCCCCGTCGAGG + Exonic
1096482679 12:51952485-51952507 CCGGCACTCATGCCCCGTGGAGG + Intronic
1096839207 12:54370417-54370439 CCTGCTCCCCAGCCCCCTGGCGG - Exonic
1097191177 12:57220330-57220352 CCGGCTCCGGGGCGCGGTGGGGG - Intronic
1097267756 12:57755616-57755638 CCGCCTCCCCGGCCCCCCCGGGG - Exonic
1100444826 12:94650593-94650615 CCGCCTCCCCCACCCCGCGGCGG - Intergenic
1102197146 12:111033953-111033975 ACGGCTCCCGGGCCCGTTGGCGG + Intergenic
1103147147 12:118604727-118604749 CCTGATGCCCGGCCCTGTGGTGG - Intergenic
1104602343 12:130162304-130162326 CGGGCTCCCGGGCCCCGCGGGGG - Intergenic
1104785637 12:131446413-131446435 CAGGTGCCCCAGCCCCGTGGAGG - Intergenic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1114674204 14:24430131-24430153 CCCGCTCCCGGGCGCGGTGGAGG - Intronic
1117562391 14:56954414-56954436 GAGGCTCCCCCGCCCAGTGGAGG - Intergenic
1117625859 14:57637449-57637471 CCAGCTCCCTGGCCCTGTGGTGG + Intronic
1118339149 14:64880002-64880024 CCGCCTCCCCGCCCCCGCCGCGG - Intergenic
1118389972 14:65287638-65287660 CCGGCTCCCAGGCCCCCAGAGGG - Intergenic
1121828884 14:97033248-97033270 CGGGCTCCCTGGCCCTGAGGTGG - Intergenic
1122550159 14:102545065-102545087 CCGGCTCCCCGGGCGGGGGGTGG + Intergenic
1127922441 15:63504325-63504347 CCGCTTCCCCGGCCCCGGGAAGG - Intergenic
1128726270 15:69990770-69990792 CCGCCTCCCCTGCCCTGTGTGGG - Intergenic
1129348214 15:74937915-74937937 CCGGACCCCCGGCCCCGCCGTGG - Exonic
1129461415 15:75701820-75701842 CTGGCTCGCCAGCCCCGTGAAGG + Intronic
1129723418 15:77889987-77890009 CCGGCTCGCCAGCCCCGTGAAGG - Intergenic
1129752739 15:78077352-78077374 CCGGCTCCGCCGCCTCGTCGGGG + Exonic
1132664262 16:1074410-1074432 CCGACTCCCCGACCTCGTGCTGG + Intergenic
1133463808 16:6010330-6010352 CCAGCTCCCTTGCCCCGGGGTGG + Intergenic
1136141934 16:28293516-28293538 GCAGCTCCCCGGCCCCACGGAGG + Intronic
1136464026 16:30429791-30429813 CCCGCTTCCCGACCACGTGGAGG + Intronic
1136993286 16:35170253-35170275 CGGGGTCCCGGGCCCCGCGGCGG - Intergenic
1138456742 16:57125360-57125382 CCAGGTCCCAGGCCCCTTGGTGG + Intronic
1139402881 16:66696418-66696440 CTGGCTCACCGGCTCGGTGGTGG + Exonic
1140022942 16:71256050-71256072 CCAGCTCCCCTGCCCAGTGAGGG + Intergenic
1141683014 16:85555004-85555026 CCGGCTCGGCGGCCGCGCGGGGG + Intergenic
1141712543 16:85708334-85708356 CCTGCTCCCAGGACCAGTGGGGG - Intronic
1142137013 16:88456074-88456096 CCGGCTCCCCGGCCCCAACCCGG - Intronic
1143483364 17:7239312-7239334 CGGGATCCCCGGCTCCGGGGAGG - Exonic
1147307441 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG + Intergenic
1147743134 17:42679913-42679935 CCGGCGCTCGGGCCCCCTGGCGG + Exonic
1149296314 17:55265220-55265242 CGGGCTCCCCGGCGACGTGCAGG - Exonic
1151314006 17:73311104-73311126 CCGTCTCCCCGGCTCCAAGGGGG + Intronic
1151421119 17:73998681-73998703 CCTGCTCCCAGGCTCCGTGTGGG - Intergenic
1151783835 17:76265638-76265660 CCCGCGGCCCGGCCCCGCGGCGG - Intronic
1152638464 17:81439736-81439758 CCGCCTCCCAGGCCCTGTGGGGG - Intronic
1153636615 18:7118003-7118025 CCGCCTCCCCGGCTCCGGGTAGG + Intergenic
1155507544 18:26548097-26548119 CTGGCGCCCCGGGCCCGCGGTGG - Intronic
1157094868 18:44679195-44679217 CCCGCTCCCCGGCGCCCTTGCGG - Intergenic
1160778935 19:869240-869262 CAGGCTCCCCGGGCACGTGGCGG - Intronic
1161073332 19:2273111-2273133 CCGGATGCCCAGCCCCGAGGCGG - Exonic
1161585327 19:5102536-5102558 CCTGCTCCCCTGGCCTGTGGAGG - Intronic
1161595364 19:5148563-5148585 CCAGCTCCCCGGCCCCGACTCGG - Intronic
1163118300 19:15200888-15200910 ACGGGCCCCCGGCCCCATGGCGG + Exonic
1163469623 19:17488826-17488848 CCGGCTCCCCCTCCCCCTGCAGG + Exonic
1163710724 19:18845218-18845240 CCCGCTGCCTGACCCCGTGGTGG + Intronic
1163722930 19:18906792-18906814 CCAGCTCCCCTGCCCAGTGTGGG - Intronic
1163843968 19:19628302-19628324 CCGCCTCCACGGCCGCGTCGGGG + Intronic
1164624100 19:29715207-29715229 CCAGCTCCCCAGCCCCGCGGAGG + Intronic
1165861606 19:38912047-38912069 CCCGCTCCCCGGCCCCTGGCAGG + Intronic
1166071428 19:40390246-40390268 CCCCCTCCCCCGCCCAGTGGCGG + Intergenic
1166780593 19:45340711-45340733 CCGGCTGCCCCGCCCCTCGGAGG + Intronic
1167134295 19:47608240-47608262 CCGCCTCCCCGGCGCCGCCGTGG + Exonic
1167946484 19:52992902-52992924 CCGCCTCCCCCGTCCCGAGGAGG - Intergenic
1168239530 19:55082193-55082215 CCCGCGCCCCGGCCCAGGGGCGG - Intronic
1168689480 19:58368257-58368279 CCGGCTCCCGACCCCCGTCGGGG + Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1168721777 19:58558407-58558429 CGGGGTCCCGGGCCCCGCGGCGG - Exonic
927658366 2:24971430-24971452 CCGGCTCCCAGGCCCGGCTGGGG + Intronic
928511776 2:32010097-32010119 TCGGCGGCCCGGCCCCGCGGCGG - Intronic
928615425 2:33033985-33034007 CCCCCTCCCCGGCTCCCTGGGGG + Intronic
930725206 2:54675335-54675357 CCTGCTGCCTGGCCCCGTGGCGG + Intergenic
931256912 2:60581894-60581916 CCGCCTCCACCGCCCCGCGGGGG + Intergenic
932305397 2:70698304-70698326 CCCTCTCCCCAACCCCGTGGAGG + Intronic
938258740 2:129880477-129880499 CCTGACCCCCGGCCCCGTGATGG + Intergenic
939522428 2:143247311-143247333 CGGGCTCCACAGCCCAGTGGCGG - Intronic
940971989 2:159904832-159904854 GCGTCTCCTCGGCCCCGGGGCGG + Intergenic
941384833 2:164841009-164841031 CAGCCTCCCCGGCCGCGTGGAGG + Intronic
941951268 2:171160123-171160145 CCGGCTCCCCGGCTCTGGGGAGG - Intronic
942444062 2:176066847-176066869 CCGGGTCCCCGACCGCGTGGCGG - Intergenic
947552602 2:231057172-231057194 CCAGCCCCCCGGCCCGGGGGTGG - Intronic
947641429 2:231709632-231709654 GGGGCGCCCGGGCCCCGTGGCGG + Intronic
948752961 2:240143096-240143118 CCGGCTCCCCTGCACCCTGGAGG + Intronic
948785363 2:240349683-240349705 CCGGCTCCCCTGCCATGGGGTGG + Intergenic
948897931 2:240935811-240935833 CGGGCTCCCCTGCCAAGTGGCGG - Intronic
1169083863 20:2815239-2815261 CCAGCACCCAGGCCCCTTGGAGG - Exonic
1169214738 20:3786524-3786546 CCGGGCCCCCCGCCCCGGGGCGG - Exonic
1174648484 20:52105132-52105154 CCGGCTCCCCCGCCACCTGCGGG + Intronic
1175859577 20:62143171-62143193 CCGCGTCCCCGGCCCCGCGCAGG + Intronic
1175996124 20:62813060-62813082 CCGGGTCCCCTGCCCCATCGGGG + Exonic
1176121664 20:63456869-63456891 CCAGGTCCCCAGCCCCGGGGAGG - Intronic
1176242826 20:64083018-64083040 CCCTCTCCCTGGCCCCCTGGTGG + Intronic
1179490943 21:41741251-41741273 CCGTCTCCGCGGCCACGTGCAGG + Exonic
1179563681 21:42233344-42233366 CCCGCCCTCCTGCCCCGTGGAGG + Intronic
1180083686 21:45497985-45498007 GCCGACCCCCGGCCCCGTGGAGG - Intronic
1181052753 22:20245547-20245569 CCTCCTCCCTGGCCCCATGGTGG + Intronic
1181057707 22:20267885-20267907 CTGGCGCCCCGGCCCCGGGAGGG - Intronic
1181085488 22:20437702-20437724 CCGGCTCCCCGGCGCCGCGCCGG + Exonic
1181513624 22:23399722-23399744 CCGGGGCCCCGGCCCAGTAGTGG - Intergenic
1183334273 22:37237708-37237730 CTGCCTCCCCGACCCCGGGGAGG - Intronic
1183979350 22:41530639-41530661 CCGGCTCTCCCGCCTCATGGGGG + Intronic
1184214745 22:43059337-43059359 CCGGCTCCCAGGGCCCGTTTGGG - Intronic
1184456857 22:44615887-44615909 CCAGCTCCCTGTCCCTGTGGAGG + Intergenic
1184748641 22:46471818-46471840 TCAGCTCCCCTGCACCGTGGTGG + Intronic
1185386138 22:50532017-50532039 CCGGCCCCGCGGCCCCATCGCGG - Exonic
949559377 3:5187969-5187991 CCGGCCCACGGGCCCCGAGGTGG - Exonic
950043043 3:9932715-9932737 CCGGCTCCCCATTCCCCTGGGGG + Intronic
950531010 3:13552391-13552413 CCGGCTGTCCTGCCCGGTGGTGG + Intronic
951184962 3:19702667-19702689 CCGGCTGGCCGGCCCTGTGGAGG + Intergenic
951543741 3:23806377-23806399 CCCGCTCCCGGGCCCCTCGGTGG - Intronic
952152423 3:30607062-30607084 CCGGCAACCCGGCCCCCGGGCGG + Intronic
953957010 3:47239460-47239482 CCAGCTTCCCAGACCCGTGGAGG + Intronic
956675034 3:71725319-71725341 GCGGCTCCCGGGCCCCGGCGGGG + Exonic
961389204 3:126542423-126542445 GCGGCTCCCCGGGGCCGCGGCGG - Exonic
968161638 3:196432021-196432043 CCGGGTCCCCGGGCCGGCGGGGG + Intronic
968196718 3:196712688-196712710 CCGGCTCCCGGGCCTCTCGGCGG + Intronic
968199559 3:196740264-196740286 GCGGCTCCCCGGCCCCGCGCGGG - Intronic
969692275 4:8710245-8710267 CCCCCTCCCCGGCCCACTGGAGG - Intergenic
980941646 4:139280278-139280300 CCGCCTCCGCGGCCCCCGGGAGG + Exonic
984793209 4:183633112-183633134 CAGGGTCCCGGGGCCCGTGGTGG + Intergenic
992106243 5:73451305-73451327 CCGGCTCCCCGCCCCCAAGCTGG + Intergenic
992594771 5:78334954-78334976 CTGGCTGCACGGCCCTGTGGTGG - Intergenic
996091472 5:119355942-119355964 CCCGCTCTCCCGCCCCGGGGAGG + Intronic
997453988 5:134004517-134004539 CCGGCAGCCCGGCCGCGGGGAGG - Intronic
998424201 5:142013029-142013051 CCGGCGGCCCGGCCCCGCGCGGG + Intronic
999395270 5:151223227-151223249 CCAGCTCCAAGGCCCCTTGGGGG + Intronic
1001257167 5:170192934-170192956 CCGGCTCCCCCACCGCCTGGTGG + Intergenic
1002434378 5:179221882-179221904 CCTGCTCCTCAGCCCCATGGGGG - Intronic
1004044596 6:12012141-12012163 CCGGCTGCCCGGCTCCCTGGCGG + Intronic
1007634580 6:43290973-43290995 CCAGCTCTCCTGCCCCATGGCGG - Intergenic
1012548355 6:100446690-100446712 CCGGCGCCCAGGCCCCGCGCGGG - Intronic
1017738121 6:157381640-157381662 CCGGCTCCCCGGCCGCGCCTCGG - Exonic
1019175800 6:170158909-170158931 CGGGCGCTGCGGCCCCGTGGGGG + Intergenic
1019274971 7:171484-171506 CCGGCTCCCCGACCCCCTCCCGG + Intergenic
1019274981 7:171503-171525 CCGGCTCCCCGACCCCCTCCCGG + Intergenic
1019437055 7:1027901-1027923 CAGGCTCCCCTGCGCTGTGGGGG - Intronic
1022400120 7:30028627-30028649 CCGGCGCCCGGGCCCGGTGTGGG - Exonic
1023842263 7:44104288-44104310 CCGGCTCCCCACCCCCGGGGAGG - Intergenic
1024579846 7:50793019-50793041 CCGGCGCCCCGGGCCCGCAGCGG - Intronic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1026968586 7:74454700-74454722 CCCCCGCCCCGGCCCCGGGGAGG + Intronic
1027773961 7:82443138-82443160 CCCAGTGCCCGGCCCCGTGGAGG + Intronic
1029640423 7:101816441-101816463 CCCCCTCCCCGGTCCCGCGGCGG - Intronic
1032117059 7:129126494-129126516 CGGGCTCCGCGGGCCGGTGGCGG - Intergenic
1034275482 7:149822036-149822058 CCTGCTCCTGGGGCCCGTGGGGG + Intergenic
1035360646 7:158311131-158311153 CCGGCTCCCCTGACCTGTGCCGG + Intronic
1036753996 8:11460465-11460487 TCTACTCCCTGGCCCCGTGGGGG - Intronic
1036787981 8:11700626-11700648 CCGGCGCCCAGGCCCAGCGGGGG + Intronic
1037273733 8:17156517-17156539 CCGGCTCCTCAGCCCGGCGGAGG - Exonic
1038017622 8:23528893-23528915 CAGGCGCCGCGGCCCCGGGGAGG + Exonic
1038444359 8:27593072-27593094 CCGCCCCCCCGGCCCCGCGCAGG - Intergenic
1038798281 8:30727992-30728014 CCAGTTCCCCGCCCCGGTGGCGG + Intergenic
1049184288 8:141241261-141241283 ACGGCTCACCGGCAACGTGGTGG + Intronic
1049194095 8:141306168-141306190 CCACCTCCCGGGCCTCGTGGGGG - Intronic
1049532150 8:143160072-143160094 CCGGCCCCCCAGCCCAGGGGTGG - Intronic
1049673604 8:143880206-143880228 CCAGATCCCCTGCCCTGTGGTGG + Intergenic
1049991848 9:998580-998602 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991869 9:998678-998700 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991890 9:998776-998798 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991911 9:998874-998896 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1049991932 9:998972-998994 CCGGCTCTGCTGCCCCCTGGAGG + Intergenic
1051170601 9:14315455-14315477 CCGGCGCCCCGGGCCCCGGGGGG - Intronic
1053435011 9:38068730-38068752 TCGGCGCCCCGGCCCCGGCGGGG + Exonic
1057490723 9:95517368-95517390 CCTGCTCCCCGCCCCTCTGGCGG - Intergenic
1059414871 9:114156226-114156248 CCGGCTGCCCGATCCCGTTGGGG + Intronic
1060114373 9:120928913-120928935 CGGGCGCCCCGGCCCCGCAGGGG - Intronic
1060389884 9:123268512-123268534 CCGGCTCCTCTGCCCAGCGGCGG + Intronic
1061073006 9:128323157-128323179 CCCGCGCCTCGCCCCCGTGGGGG + Intronic
1062352481 9:136145852-136145874 CTGGCTTCCCGGCACCCTGGGGG + Intergenic
1203794675 EBV:169996-170018 CCCGCTCCCCGCCCCCCTTGGGG - Intergenic
1203794876 EBV:170534-170556 CCCGCTCCCCGCCCCCCTTGGGG - Intergenic
1203795067 EBV:171057-171079 CCCGCTCCCCGCCCCCCTTGGGG - Intergenic
1203795268 EBV:171595-171617 CCCGCTCCCCGCCCCCCTTGGGG - Intergenic
1185464424 X:346314-346336 CCGGCTCCCGGTCTCCGTGCGGG - Intronic
1192214685 X:69150221-69150243 CCGGCGCCCCCTCCCCGTGCCGG - Intergenic
1192224895 X:69221542-69221564 CCGGCGCCCCCTCCCCGTGCCGG + Intergenic
1195636194 X:107118513-107118535 CCAGCTCCCGGGGCCCGTGCCGG + Intronic
1197709337 X:129654644-129654666 CCGGCTCGCCGGGGCCGCGGCGG - Exonic
1198100157 X:133415724-133415746 CTGGCTCCCCGCCTCCGAGGAGG - Intergenic
1200216518 X:154370517-154370539 CCTGCGCCCCGTCCCCGAGGAGG - Intronic