ID: 1067683769

View in Genome Browser
Species Human (GRCh38)
Location 10:48455580-48455602
Sequence GCTCCCTGGCCCATGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 259}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067683769_1067683779 8 Left 1067683769 10:48455580-48455602 CCCTGGGACATGGGCCAGGGAGC 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1067683779 10:48455611-48455633 CAGGCCTGGTGGCCATCCCAAGG No data
1067683769_1067683784 28 Left 1067683769 10:48455580-48455602 CCCTGGGACATGGGCCAGGGAGC 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1067683784 10:48455631-48455653 AGGTCCCCTGCAAGACGATGTGG No data
1067683769_1067683774 -3 Left 1067683769 10:48455580-48455602 CCCTGGGACATGGGCCAGGGAGC 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1067683774 10:48455600-48455622 AGCCCCTTCCACAGGCCTGGTGG No data
1067683769_1067683785 29 Left 1067683769 10:48455580-48455602 CCCTGGGACATGGGCCAGGGAGC 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1067683785 10:48455632-48455654 GGTCCCCTGCAAGACGATGTGGG No data
1067683769_1067683773 -6 Left 1067683769 10:48455580-48455602 CCCTGGGACATGGGCCAGGGAGC 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1067683773 10:48455597-48455619 GGGAGCCCCTTCCACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067683769 Original CRISPR GCTCCCTGGCCCATGTCCCA GGG (reversed) Intronic
900331625 1:2137651-2137673 GAGCCCTGGCCCATGTCACTGGG - Intronic
900487940 1:2932359-2932381 GGTCTCTATCCCATGTCCCATGG - Intergenic
900872022 1:5311113-5311135 ATTGCCTCGCCCATGTCCCAAGG + Intergenic
901651708 1:10746854-10746876 GCTCCATGGCCCAGGAGCCAGGG - Intronic
902249002 1:15141109-15141131 GGTCCCTGGGCCGTGTCCCACGG + Intergenic
902553913 1:17235556-17235578 GCTCCTGAGCCCAGGTCCCAAGG - Intronic
904054818 1:27663033-27663055 GCTCCCAGACCCAAGTCACAAGG - Intergenic
906035428 1:42747694-42747716 GCTCCCTTGTCCTTGTCCCTGGG - Intronic
906072740 1:43029023-43029045 GCTACCTGCCCCAGGTCACACGG - Intergenic
907701421 1:56792017-56792039 CCTCCCTAGCCCCTGTCCCATGG + Intronic
908409383 1:63847450-63847472 TCTCCCTGGCCCTTGTCCAAGGG - Intronic
909100680 1:71344032-71344054 GCTCCATGTCCCATGTGGCATGG + Intergenic
911154581 1:94625557-94625579 GCTCCCGGGCCCGTTTCCTAAGG + Intergenic
912369358 1:109161758-109161780 GCTCCCTGCCCGGGGTCCCAGGG + Intronic
913170865 1:116230989-116231011 GCTCCCTGGCCCTCCTCCCAGGG - Intergenic
913174702 1:116263101-116263123 GCTCTCTGGGCATTGTCCCATGG + Intergenic
914681321 1:149940466-149940488 GCTCTCTGCCCCATCTCCAATGG - Exonic
914922965 1:151859939-151859961 GCCCCCTGGGCCATGGCACAGGG + Intergenic
914922968 1:151859942-151859964 GGTCCCTGTGCCATGGCCCAGGG - Intergenic
919832745 1:201553284-201553306 GCTCAGTGGCCCATGGGCCAGGG + Intergenic
920166754 1:204041528-204041550 GGTCCCTGGCCCAGGTCCCCAGG - Intergenic
920693355 1:208163540-208163562 GCTCCCTACCCCATGCCCCTTGG - Intronic
920853089 1:209642050-209642072 GCTCCTTGTCCCATGGCCCAGGG - Intronic
921672991 1:217946863-217946885 CCTCCCTGCTCCATCTCCCACGG - Intergenic
922216444 1:223523881-223523903 CCTCCCTGACACATGTGCCAGGG + Intergenic
922216445 1:223523884-223523906 GCTCCCTGGCACATGTGTCAGGG - Intergenic
924626708 1:245701845-245701867 GCTGCCTGGCCCAGGTCCAGGGG - Intronic
1062856330 10:781243-781265 GCTCCGTGGCCCTGGTACCACGG + Intergenic
1064175037 10:13067210-13067232 GGTGCATGGCCCATGGCCCAAGG + Intronic
1064928236 10:20593882-20593904 TCTCCCTGTCCCAGGACCCAGGG - Intergenic
1067663653 10:48255406-48255428 CCTCCCTCTCCCATGTGCCATGG + Intronic
1067683769 10:48455580-48455602 GCTCCCTGGCCCATGTCCCAGGG - Intronic
1067765162 10:49080382-49080404 CCTCCCTGGCCTAGGCCCCAGGG + Intronic
1070948048 10:80409024-80409046 GCCCCCGGGCCCATGCTCCAGGG - Intronic
1071477383 10:86036407-86036429 GCACCCTGGCAGATTTCCCAAGG + Intronic
1071510970 10:86262429-86262451 GCCCCCTGGTCCATGCCACAGGG + Intronic
1071553733 10:86586522-86586544 CCTCCCTTCCCCATGCCCCAGGG - Intergenic
1072198604 10:93138660-93138682 TCTCCTTGGACAATGTCCCAAGG + Intergenic
1072695790 10:97601875-97601897 GCGCCCTGGCCAATGTCCTGGGG + Exonic
1073544932 10:104339686-104339708 ACTCCCTGGCCCTTGGCCCAGGG + Intergenic
1076385773 10:130053982-130054004 GCATACTGGCCCATGACCCACGG - Intergenic
1076479208 10:130773563-130773585 GGTCCCCGGGCCATGACCCAGGG + Intergenic
1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG + Intergenic
1077192790 11:1262422-1262444 GCCCCCTGCCCCCTGTCCCCTGG - Intergenic
1077451875 11:2653321-2653343 GCCCCCAGGCCCATGTCCGTAGG + Intronic
1078958069 11:16226425-16226447 CCTCCCTGGGCAATGTGCCAGGG - Intronic
1079159459 11:17978601-17978623 GCTCACTGGCCCTTGTCCCCTGG + Intronic
1079284474 11:19116926-19116948 CCTCCCTGCCCCAGGTGCCACGG - Intergenic
1079305386 11:19317052-19317074 TCTCTCTGGCCCATCTCCCCTGG + Intergenic
1079658793 11:23015987-23016009 CCTGCATGGCCCATGTTCCATGG + Intergenic
1081585410 11:44380561-44380583 CCTCTCTAGCCCCTGTCCCATGG - Intergenic
1081912875 11:46711369-46711391 GCTCCATGTACCATGTACCAGGG - Intergenic
1081935869 11:46903666-46903688 CCTCCCTGGCCAACATCCCAGGG - Intronic
1081990367 11:47334081-47334103 GCTCTCTGGGCCTTGTCTCAAGG - Intronic
1083310007 11:61779230-61779252 GGCCCATGGCCCATGGCCCATGG + Intronic
1083310010 11:61779237-61779259 GGCCCATGGCCCATGGCCCATGG + Intronic
1083366071 11:62142142-62142164 GCTCCCTGTGCCATTTGCCAAGG + Intronic
1083724283 11:64620200-64620222 GCCACCTGGCCCAAGCCCCAGGG - Intronic
1084758142 11:71251966-71251988 GCTCGCTGGCCCGGGTCCTAGGG + Intronic
1085773099 11:79342152-79342174 GCTGCCTGGCCCAAGTACCAGGG + Intronic
1086532709 11:87804477-87804499 TCTTCCTGTCCTATGTCCCAGGG - Intergenic
1087192304 11:95267923-95267945 GCTCCATGGCCCATGCCACAAGG + Intergenic
1089261969 11:117229726-117229748 CCTGCCAGGCCCATGACCCAGGG + Exonic
1090443580 11:126744650-126744672 GCTCCCTGGCGTGTGCCCCATGG + Intronic
1093082317 12:14827299-14827321 GCTCCCAGAGCCATGTCCCCAGG + Exonic
1096197348 12:49657190-49657212 ACTGCCTGGCCCATCTCCCCAGG - Exonic
1098460591 12:70729067-70729089 TCTCCCTGGTCCAGGTCGCAAGG - Intronic
1103291242 12:119848058-119848080 GTTCCATGCCCCATGTCTCAAGG + Intronic
1103360634 12:120351444-120351466 CCTCCCTGGGCCATGTCCAAGGG - Intronic
1103727074 12:123003299-123003321 GCTCCTGGGCCCATTTCCCCAGG + Intronic
1103839181 12:123848897-123848919 GCCCCCGGGACCATGTCCCTAGG + Intronic
1103889489 12:124228011-124228033 GCTCCCAGGCTCACCTCCCACGG + Intronic
1103917965 12:124385641-124385663 CCTCCCTGGCCCATGCCTCCTGG + Intronic
1104662062 12:130618389-130618411 GCTCCTTGGACCAGGGCCCATGG - Intronic
1104744570 12:131202851-131202873 GCTCCCTGGGCCCTGCTCCAGGG + Intergenic
1104789815 12:131474356-131474378 GCTCCCTGGGCCCTGCTCCAGGG - Intergenic
1104972314 12:132537438-132537460 CCTCCCTGGCCCGTGTCCCAGGG + Intronic
1105439408 13:20402896-20402918 GCTGCCTGCCCCATGTGCCCTGG - Intergenic
1107817091 13:44254076-44254098 CCTGCATGGCCCATGTTCCACGG - Intergenic
1108182360 13:47853706-47853728 GCTCCCTGACCCTTATTCCATGG - Intergenic
1108594255 13:51936431-51936453 GCTCCCTGCCCCCTGCCCCCAGG - Intronic
1110528702 13:76571440-76571462 GCTACCATGCCCATGCCCCATGG + Intergenic
1112357962 13:98690571-98690593 GCTGCCTGGCCTATGTCTTAGGG + Intronic
1113047697 13:106173571-106173593 CTGCCCTGGCCCATGTCCCCTGG - Intergenic
1113429795 13:110240309-110240331 GCTCCCTGGCCTAGGTCCCTTGG + Intronic
1114577115 14:23725557-23725579 ACTCACTGGCACCTGTCCCATGG + Intergenic
1117954306 14:61110926-61110948 GGTCCCTGGCCCCTGGCCCCTGG - Intergenic
1118819053 14:69333207-69333229 CCTCCCAGGCCCCTGACCCAGGG - Intronic
1121453297 14:94022998-94023020 CCTCCCTTGCCCCAGTCCCAGGG - Intergenic
1121782284 14:96629680-96629702 ACTCCCCAGCCCATCTCCCAGGG - Intergenic
1122277836 14:100604299-100604321 GCTCCATCCCACATGTCCCAAGG - Intergenic
1122757955 14:103997553-103997575 GCTCCCTGGCCCTGGTCTCCAGG - Intronic
1122971320 14:105153424-105153446 GCTCTCTGGCCGATGACCCAAGG - Intronic
1122974938 14:105167269-105167291 TCTCCCGGGCCTAGGTCCCACGG + Intronic
1123055194 14:105566193-105566215 CCTCCCTGGCCCAGCTCCCCTGG + Intergenic
1123079643 14:105686037-105686059 CCTCCCTGGCCCAGCTCCCCTGG + Intergenic
1123404536 15:20012008-20012030 CCACCCTGTCCCATGGCCCAAGG - Intergenic
1123513869 15:21018655-21018677 CCACCCTGTCCCATGGCCCAAGG - Intergenic
1123948495 15:25250378-25250400 TTGCCCTGGCCCATGCCCCATGG + Intergenic
1124504412 15:30260994-30261016 GCTGCCTGGCTCGTGTCACATGG - Intergenic
1124739139 15:32277641-32277663 GCTGCCTGGCTCGTGTCACATGG + Intergenic
1125749379 15:42018522-42018544 GCTCCCTGGTCCTTACCCCAGGG - Intronic
1128223129 15:65982534-65982556 GGTTCCTGGCCCCTGCCCCAAGG - Intronic
1129185830 15:73905883-73905905 CTTCCCTGGCCTCTGTCCCAGGG + Intergenic
1129721928 15:77882387-77882409 GCTGGGTGTCCCATGTCCCAGGG + Intergenic
1132243598 15:100278471-100278493 GATCCCTGGCCCAGGTCCCAGGG + Intronic
1132495892 16:263276-263298 GCTACCTGATGCATGTCCCAGGG + Exonic
1132589033 16:718354-718376 GGTCCCTGGCCCTTGAGCCATGG - Exonic
1132646166 16:1000249-1000271 GGTCCCTGTCCCCGGTCCCATGG - Intergenic
1132687859 16:1169784-1169806 GGTCCCTGGCCCCTGGCCCCAGG + Intronic
1132882124 16:2167147-2167169 GCCCCATGGCCCCTGTCACACGG + Intronic
1135945061 16:26858208-26858230 GCCATCTGGCCCATGTTCCATGG + Intergenic
1136015691 16:27399314-27399336 GCTGCCAGGCCCATGTCCACTGG - Intergenic
1136180442 16:28548309-28548331 GCTGTCTGGCCCATGCCCCACGG + Intergenic
1137227079 16:46523918-46523940 AACCCATGGCCCATGTCCCAAGG + Intergenic
1138489171 16:57366220-57366242 GCCCCCTGCCCCATCTCACAGGG - Intergenic
1139513058 16:67438126-67438148 GCTCCCAGAGCCATGGCCCATGG - Exonic
1141460881 16:84178259-84178281 GGTGCCAGACCCATGTCCCAAGG + Exonic
1141635377 16:85311489-85311511 CCTCCCTCCCCAATGTCCCACGG - Intergenic
1142876148 17:2853221-2853243 GCTCCCGGGCCCGGGTCCCCGGG - Intronic
1143022037 17:3921823-3921845 CTTGCCTGGCCCATCTCCCAGGG + Intergenic
1143315258 17:6027284-6027306 GCTCCCAGGTCCTAGTCCCATGG - Intronic
1143675697 17:8430889-8430911 GCCCCTGGGCCCATCTCCCAGGG + Intronic
1144438889 17:15263503-15263525 GCTCCCTGTCCCGTGCCTCAAGG - Intronic
1145780730 17:27561121-27561143 TCTCCCTGTCTCCTGTCCCAGGG - Intronic
1146830536 17:36065456-36065478 GCTCCTTGTCCCTTGTCCCATGG + Intronic
1147656399 17:42093443-42093465 GCTCCCAGGCCTATGACCCTGGG + Intergenic
1147704553 17:42416985-42417007 GCTTCCTGGCCCTTATCCCCAGG + Intronic
1147944289 17:44071694-44071716 GGTCCCTGGACCATGCCCAACGG + Intronic
1149386374 17:56146709-56146731 GTTTCCTGGCCCAGGGCCCAGGG - Intronic
1149602889 17:57904583-57904605 GCTCCCCGTCCCATTTCACAGGG + Intronic
1149855066 17:60075323-60075345 ACTCCATGTCCCAAGTCCCAAGG - Intronic
1151194743 17:72423551-72423573 GCTCCCAGACCAATGGCCCAGGG - Intergenic
1151725038 17:75878628-75878650 GAGCCCTGGCCTAGGTCCCAGGG - Intergenic
1152263184 17:79278232-79278254 GCTCCCTGGCCCGTGGCTCCAGG + Intronic
1152528032 17:80900705-80900727 CCTACCTGGCCCATGCTCCATGG + Intronic
1152641914 17:81452795-81452817 GCTGCCTGCCCCACGTCCCACGG + Exonic
1152748842 17:82053253-82053275 GGTGCCTGGCCCATGTTGCAGGG + Exonic
1155680507 18:28480998-28481020 GCTTCCTGCCCCGTGTCCCTCGG + Intergenic
1156883461 18:42107703-42107725 GCTCACTGGTCCAAGTTCCAAGG - Intergenic
1157580848 18:48773429-48773451 GCTCTCTGGCCCCTGGCACATGG + Intronic
1157729424 18:49990844-49990866 GCTGCTTGGCTGATGTCCCATGG + Intronic
1158494473 18:57942132-57942154 GCTCCCTGGCCCTGGACCCCAGG - Intergenic
1158629395 18:59099177-59099199 CCTCCCTGGCCCCTGCCCCAGGG + Intergenic
1159467078 18:68797498-68797520 GCTCTCTGGCCCCTTTCCCTGGG - Intronic
1160622303 18:80179934-80179956 GCTGCCTGGCCCATCTCAGAGGG + Intronic
1161428002 19:4215074-4215096 GCTTCCTGGCCTATGTGCCATGG - Intronic
1161483319 19:4521675-4521697 GCCCTCTGGACTATGTCCCAGGG + Intergenic
1161485166 19:4531600-4531622 GTGCCCTGGCCCGTGTCCCTGGG - Intronic
1161817621 19:6509587-6509609 GGTCACTGGCCCTTTTCCCAAGG + Intergenic
1162472918 19:10883132-10883154 GTTCCCTGGACAAGGTCCCAAGG - Intronic
1163522458 19:17799616-17799638 GCTACTCGGCCCAGGTCCCATGG + Intronic
1163669171 19:18617520-18617542 GTTCTGTGGCCCATCTCCCAGGG + Intronic
1163669218 19:18617724-18617746 GTTCCATGGTCCATTTCCCAGGG + Intronic
1164686463 19:30169491-30169513 GCTCCCTCTGCCATGGCCCAGGG + Intergenic
1164695461 19:30240482-30240504 CCTCCCAGGACCTTGTCCCAGGG + Intronic
1164700046 19:30278619-30278641 TCACCCTGGCCCAGGACCCAGGG - Intronic
1165157185 19:33795943-33795965 GCTCCCTGGCCGCCCTCCCAGGG - Intronic
1165487443 19:36104149-36104171 CCACCATGTCCCATGTCCCAGGG - Intronic
1168172060 19:54595778-54595800 GCTCCCTGGCCCACAGCCCCAGG + Exonic
1168288304 19:55345310-55345332 GCTCCCTGGCCCGGACCCCAAGG - Intronic
1168288529 19:55346170-55346192 GCGCCCTGGCCCAGGGCACAGGG - Intronic
1168692531 19:58385722-58385744 GCCACCTGACCCAGGTCCCAGGG - Intergenic
925341400 2:3140396-3140418 GCTACCAGGCACATTTCCCATGG + Intergenic
925990663 2:9251624-9251646 GCTCCCTTCCCCTTCTCCCAAGG - Intronic
926365967 2:12133426-12133448 GCTCCCACGCCCATTTCACAGGG + Intergenic
927267129 2:21163244-21163266 CCACCCGGGGCCATGTCCCAGGG - Intergenic
927501878 2:23588522-23588544 TCTCCCTGGCCCCTGCCCCAAGG + Intronic
931205417 2:60141122-60141144 CCCCACTAGCCCATGTCCCAGGG + Intergenic
932087531 2:68775169-68775191 GCTCACTGCCCCATGTCCCTCGG + Intronic
936432489 2:112476599-112476621 CTCCCCGGGCCCATGTCCCAAGG - Intergenic
937988028 2:127647360-127647382 GCTCCAGGGCCAATGTCCCCTGG + Intronic
938761972 2:134434153-134434175 GCTACCTGGCGCTTCTCCCAGGG + Intronic
942043462 2:172085768-172085790 TCTCCTTCTCCCATGTCCCACGG + Exonic
944661056 2:201921989-201922011 GCTCCCTGACCCCTGACCCTAGG + Intergenic
945928622 2:215831755-215831777 GTCCTCTGGCCCAGGTCCCATGG - Intergenic
947458820 2:230284139-230284161 TCTCCCAAGCCCATGGCCCAAGG + Intronic
947469061 2:230383305-230383327 TCTCCCAAGCCCATGGCCCAAGG + Intronic
948067750 2:235093834-235093856 GTTCCCTGAGCCATGTCACACGG + Intergenic
948348220 2:237317031-237317053 GCTCCCTGGCAGATGTCCCCTGG - Intergenic
1169011286 20:2252949-2252971 TCTCCCTGCCCCCTGCCCCATGG - Intergenic
1169299466 20:4429819-4429841 CCTCCCTGGGCCTTGTCCCGTGG + Intergenic
1171299116 20:24043947-24043969 GCTCCCTGGCTCTTGCCACAAGG - Intergenic
1172206514 20:33166586-33166608 GGTCTCTGGCCCAGGTCACATGG + Intronic
1172474402 20:35226550-35226572 GCTCCGCGGCCCCTGCCCCAGGG + Intergenic
1172624697 20:36340438-36340460 ACTCCCTGCCACATGTGCCACGG - Intronic
1174489086 20:50879641-50879663 TCTCCCTGGCCCCTGTTTCAGGG - Intronic
1175916734 20:62429507-62429529 GGTCCCTGGCCAATGAGCCAGGG - Intergenic
1175941270 20:62538581-62538603 GCTCCCCGGCACATGTGGCAGGG - Intergenic
1176026059 20:62986224-62986246 GCTCCCCGGCCCCTCTCCCCAGG - Intergenic
1176248875 20:64110547-64110569 TCTCCCTGGCCCCTGCCCTAGGG - Intergenic
1177535627 21:22423241-22423263 GTAGCCTGGCTCATGTCCCAAGG + Intergenic
1179712824 21:43272948-43272970 GCTCCCGGGCCCCTGTTCCTGGG - Intergenic
1180736957 22:18024437-18024459 GCCCCCTCGCCCAGGGCCCAGGG + Exonic
1180856468 22:19048984-19049006 GATCTCTGGCCCATGGCACAGGG + Intronic
1180958674 22:19752351-19752373 GCTCCCTGGCCAAGCCCCCAAGG - Intergenic
1182122958 22:27798781-27798803 CCGCCCTGGCCCACGTCCCCGGG + Exonic
1183401799 22:37609124-37609146 GATCCCTGGGCCATGACCCCTGG + Intronic
1184421677 22:44385908-44385930 GCTCCCAGGCCAGTGTCCCTCGG + Intergenic
1184646476 22:45898001-45898023 GCTGCCTGGTCCCTGGCCCAGGG + Intergenic
1184657807 22:45950599-45950621 CCTGCCTGGCCCAGGTGCCATGG - Intronic
1184679797 22:46064360-46064382 GCTCTCAGGCGTATGTCCCAGGG - Intronic
1184892923 22:47390376-47390398 GCCCCCTGGTCCATCGCCCAAGG - Intergenic
1185103791 22:48855932-48855954 GCTTCCTGGCCCATGGCAGATGG + Intergenic
1185398684 22:50605112-50605134 ACTCCCTGGCCCCAGTCCCAGGG + Intronic
949118739 3:359907-359929 GCTGCCTGGCACAAGTCACATGG - Intronic
950576651 3:13836248-13836270 GCTCCATGGCCCAAGTTCCTAGG - Intronic
952714199 3:36462470-36462492 ACTCCCTGGCTCATATCCAAAGG - Intronic
953817373 3:46170524-46170546 TCTCCCTGGCCCTAGTCCCTGGG + Intronic
954163600 3:48739197-48739219 TCTGCATGGCCCACGTCCCAGGG - Intronic
955410848 3:58654460-58654482 GCTCCCTGGCCCCTGCCTCATGG + Intronic
956780474 3:72599389-72599411 GCGCCCCGGCCAAGGTCCCAGGG - Intergenic
957996907 3:87702239-87702261 GATCCCTGGCCTCTGTCCTATGG - Intergenic
959923071 3:111891203-111891225 GGTCTGTGGCCCATGGCCCAGGG - Intronic
960250801 3:115450365-115450387 GCTTCCTGGCCCATTCGCCACGG - Intergenic
961552858 3:127679045-127679067 GCTCTCTGGCCCCTGTAGCAGGG + Intronic
962975390 3:140441799-140441821 ACTCCCTGGCCCAGCACCCAAGG + Intronic
969236622 4:5869948-5869970 GTCCCCTGGACCAGGTCCCATGG + Intronic
969687253 4:8682552-8682574 AGTCCCTTGCCCAAGTCCCATGG - Intergenic
977505358 4:97895843-97895865 ATTCCCTTGCCCATATCCCAAGG + Intronic
978318053 4:107462234-107462256 GCTTCCTCCCCCATGCCCCATGG - Intergenic
982221034 4:153125509-153125531 GCTCACTGGGCCAGGTACCATGG - Intergenic
985563709 5:604678-604700 GCTCCCGGGCCCCTGGCCCCTGG - Intergenic
986233131 5:5885101-5885123 GGTCCCTCTCCCATCTCCCACGG + Intergenic
987526229 5:19053427-19053449 GCACCTTGACCCATATCCCAGGG - Intergenic
988643588 5:33068918-33068940 GCTCCCCACCCCATTTCCCAAGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
992068790 5:73130556-73130578 GCACCCTGGCCCCTGCTCCAAGG - Intronic
992907052 5:81356966-81356988 GCTCCCTGGGCCATGTCGAGAGG - Intronic
997858919 5:137398338-137398360 TTTCTCTGGCCCATCTCCCAGGG - Intronic
999997321 5:157104661-157104683 GTTACCTGGGCCATGTCCCCTGG + Exonic
1001267599 5:170285932-170285954 GCTCCCTGCTCCCTGTGCCAAGG + Intronic
1001334646 5:170787459-170787481 GGCCCCTGGGCCATGCCCCACGG + Intronic
1003410334 6:5856320-5856342 GCTCCCTGTCCTATGTCCTGCGG + Intergenic
1005122869 6:22409971-22409993 CCTCCCTGCCCCTTATCCCAAGG + Intergenic
1005809774 6:29506725-29506747 GCTCCCTGGCCCTCCTGCCAGGG + Intergenic
1005979014 6:30821852-30821874 GGACCCTTGCCCATGTCCAAAGG - Intergenic
1006414006 6:33892899-33892921 GGTTCCTGGCCCATGGCCCTGGG + Intergenic
1007423994 6:41735272-41735294 GCTCCCTGGCCCCTATCCCGTGG - Intronic
1007605615 6:43115973-43115995 GCTCCCATGCCCCTCTCCCATGG + Intronic
1007822404 6:44570340-44570362 GCTCCATGAGCCATGTCCCAAGG - Intergenic
1007917483 6:45574752-45574774 CCTCCCTGGCTCATGTTTCAAGG - Intronic
1013269727 6:108534584-108534606 CCTCCCTGGCCCCTGCCCCCTGG - Intergenic
1015702917 6:136055797-136055819 GCCCCCTTGCCCATGCCACATGG - Intronic
1016078713 6:139829696-139829718 GCTGCTTTGCCCATTTCCCAGGG + Intergenic
1016199790 6:141394254-141394276 CCTCCCAGGGCCATGTCCCTGGG + Intergenic
1019215795 6:170443154-170443176 GCTCCCAGGGCCACCTCCCAGGG + Intergenic
1019328727 7:452457-452479 GCTCCCGGCCCCACGCCCCAGGG + Intergenic
1019768948 7:2871299-2871321 GCTCCCTGACCCCAGTCCCTTGG - Intergenic
1019912275 7:4107747-4107769 GCTGCCTGGGCAATGTCTCAGGG - Intronic
1020089931 7:5333270-5333292 GCTCCCAGCCCCTTGCCCCATGG + Intronic
1022738631 7:33100079-33100101 GCTCCCTGGCCAAGGTGCCAGGG - Intronic
1023988664 7:45114252-45114274 TCTCCCTTCCCCCTGTCCCATGG + Intergenic
1025022618 7:55491590-55491612 GCTCCCTGGCCTGTGTCCTAAGG + Intronic
1025190127 7:56890058-56890080 ATTGGCTGGCCCATGTCCCACGG + Intergenic
1025611811 7:63081162-63081184 ACTCCATTGCCCCTGTCCCAGGG + Intergenic
1025787724 7:64658841-64658863 GCTGCCTGGGCCATGTCAAAAGG + Intergenic
1028052012 7:86200081-86200103 GCACAATGGCCCATGGCCCATGG - Intergenic
1029439097 7:100577513-100577535 TCTCCCTGTCCCCTGCCCCAGGG + Exonic
1029608538 7:101614471-101614493 GATCCAGGTCCCATGTCCCAAGG + Intronic
1032000030 7:128259287-128259309 ACTGCCTGGCAGATGTCCCAGGG + Intergenic
1032433600 7:131882491-131882513 GCTCCCTCCCCCAAGTCACATGG + Intergenic
1032703162 7:134399454-134399476 GCTTCTTGGCCCATCTACCAAGG - Intergenic
1034267932 7:149790166-149790188 CCTCCCTGGTCCAAGTCCCTTGG - Intergenic
1034896373 7:154878859-154878881 GCTCCTTAGCACATGACCCAGGG - Intronic
1036771694 8:11582928-11582950 GCTCCCTCTCCCATTTCTCATGG - Intergenic
1039558627 8:38495394-38495416 GCTCCGTGGCTCATGCCACACGG - Intergenic
1039895913 8:41716389-41716411 GCTGCCTGGGCCAGGTCTCATGG + Intronic
1048721853 8:137334754-137334776 TCTCCCTGCACCATGTCCGAAGG + Intergenic
1049830595 8:144699146-144699168 CCTCACTGCCCCATCTCCCAGGG - Intergenic
1054455245 9:65427046-65427068 TCTCCCTGGCCCATGGCCTCGGG + Intergenic
1056423968 9:86457723-86457745 CCTCCCTGGCCTACATCCCAGGG - Intergenic
1056591493 9:87969027-87969049 GCTCCAAGGCCCCTGTCCCCTGG + Intronic
1057046520 9:91890251-91890273 GCTCCCTGGCCCCTGTGCCTGGG - Intronic
1060116702 9:120947105-120947127 GATCCCTGATCCATGACCCATGG - Intergenic
1060798162 9:126526596-126526618 GCTGCCTGGTCCCAGTCCCAGGG - Intergenic
1060981156 9:127792955-127792977 GCTCCCTGGCCCTTGGCACTTGG - Intergenic
1061203668 9:129151009-129151031 CCTCCATGGCCCATCTCCCAGGG - Intergenic
1062021916 9:134323782-134323804 GCACCCAGGCCCCTGCCCCATGG + Intronic
1062044169 9:134417544-134417566 GGCCCCTGGCCCCTGCCCCATGG - Intronic
1062239879 9:135531222-135531244 GCTCCCGGCCGCATGCCCCATGG - Intergenic
1062516968 9:136941707-136941729 GGTCCCTGTCCAATGCCCCAAGG + Intronic
1185507674 X:642516-642538 TCTCCCTGGCCCAGGCCCGAAGG + Intronic
1185674260 X:1836027-1836049 GGTCTCTGGCTCATGCCCCACGG + Intergenic
1187509551 X:19905357-19905379 GCACCCTGGTCCAACTCCCATGG + Intergenic
1188091258 X:25968198-25968220 CCTCCCTGGCCCAAGGCTCAAGG + Intergenic
1188798028 X:34490511-34490533 TCTCTCTGGCCCATGGCCCTAGG + Intergenic
1189265551 X:39713377-39713399 ACTGCCTGGCCCATGTTACATGG + Intergenic
1190649345 X:52554197-52554219 TCTCTCTGGAACATGTCCCAGGG + Intergenic
1191930359 X:66365381-66365403 GCTGCCTGCCCCACCTCCCAGGG + Intergenic
1192805669 X:74506398-74506420 GCTCCCTGCCCCATATCACTAGG - Intronic
1196496173 X:116327714-116327736 CCTCCCTGGCCCGTTTCCCCTGG + Intergenic