ID: 1067684295

View in Genome Browser
Species Human (GRCh38)
Location 10:48457706-48457728
Sequence TGCTAAAGCCTCACCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 139}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067684295_1067684304 9 Left 1067684295 10:48457706-48457728 CCAGGCCTGGTGAGGCTTTAGCA 0: 1
1: 0
2: 0
3: 4
4: 139
Right 1067684304 10:48457738-48457760 CCCAGGACCTGGGGCTAAAGGGG No data
1067684295_1067684297 -8 Left 1067684295 10:48457706-48457728 CCAGGCCTGGTGAGGCTTTAGCA 0: 1
1: 0
2: 0
3: 4
4: 139
Right 1067684297 10:48457721-48457743 CTTTAGCAGAAGAGAAGCCCAGG No data
1067684295_1067684301 7 Left 1067684295 10:48457706-48457728 CCAGGCCTGGTGAGGCTTTAGCA 0: 1
1: 0
2: 0
3: 4
4: 139
Right 1067684301 10:48457736-48457758 AGCCCAGGACCTGGGGCTAAAGG No data
1067684295_1067684299 -1 Left 1067684295 10:48457706-48457728 CCAGGCCTGGTGAGGCTTTAGCA 0: 1
1: 0
2: 0
3: 4
4: 139
Right 1067684299 10:48457728-48457750 AGAAGAGAAGCCCAGGACCTGGG No data
1067684295_1067684300 0 Left 1067684295 10:48457706-48457728 CCAGGCCTGGTGAGGCTTTAGCA 0: 1
1: 0
2: 0
3: 4
4: 139
Right 1067684300 10:48457729-48457751 GAAGAGAAGCCCAGGACCTGGGG No data
1067684295_1067684302 8 Left 1067684295 10:48457706-48457728 CCAGGCCTGGTGAGGCTTTAGCA 0: 1
1: 0
2: 0
3: 4
4: 139
Right 1067684302 10:48457737-48457759 GCCCAGGACCTGGGGCTAAAGGG No data
1067684295_1067684298 -2 Left 1067684295 10:48457706-48457728 CCAGGCCTGGTGAGGCTTTAGCA 0: 1
1: 0
2: 0
3: 4
4: 139
Right 1067684298 10:48457727-48457749 CAGAAGAGAAGCCCAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067684295 Original CRISPR TGCTAAAGCCTCACCAGGCC TGG (reversed) Intronic
900325503 1:2106786-2106808 TGCTGAAGAGTCACCTGGCCTGG - Intronic
900916819 1:5645166-5645188 TGCTCAGGCCTCACGAGGGCAGG - Intergenic
902834663 1:19038752-19038774 TGCAAAAGCCTCCCCAAGGCTGG + Intergenic
903194415 1:21674094-21674116 TTCTAAAGTCAAACCAGGCCAGG + Intergenic
910542307 1:88373891-88373913 TGCTACTGCCACACCAGCCCTGG - Intergenic
916549930 1:165840212-165840234 TTTTAAAGGCTGACCAGGCCGGG - Intronic
921168634 1:212526061-212526083 TGCTCAAGCCTCACTTGGCCTGG + Intergenic
923007022 1:230058224-230058246 TGCTGATGCTTCACCAGCCCAGG - Intronic
1063081787 10:2774291-2774313 TGCTGAACCCTCTGCAGGCCAGG - Intergenic
1063271937 10:4519540-4519562 ACCTAAAACCTCACCAGGGCTGG - Intergenic
1063348945 10:5337103-5337125 AGGTGAAGCCTGACCAGGCCAGG + Intergenic
1064247565 10:13681230-13681252 TGCTACAGCCTCTCCCGGGCTGG + Intronic
1064340210 10:14478679-14478701 TGCCAGAGCCTCAGCAGGGCAGG + Intergenic
1067262746 10:44708640-44708662 TGCAAAGTTCTCACCAGGCCAGG + Intergenic
1067684295 10:48457706-48457728 TGCTAAAGCCTCACCAGGCCTGG - Intronic
1069437411 10:68397831-68397853 TATTAAAACTTCACCAGGCCGGG + Intronic
1070791175 10:79190261-79190283 TGCTGATGCCTGCCCAGGCCAGG - Intronic
1072784377 10:98269742-98269764 TGCCAATCACTCACCAGGCCTGG + Intergenic
1073458391 10:103651400-103651422 TGCTAAAGCCCCACTGGGGCAGG - Intronic
1075577195 10:123585924-123585946 TCCTGAAGCCTCCCCATGCCTGG + Intergenic
1076472065 10:130725785-130725807 TGCAACAGCCTCACCTGACCCGG - Intergenic
1078556542 11:12331511-12331533 AGCGAAAGCCTCTCCAGGACCGG + Intronic
1079852316 11:25551213-25551235 TGCTAAAGCCTTTCAAGGCAAGG - Intergenic
1080681286 11:34478548-34478570 TGCTAAATCCACACCACACCTGG - Intergenic
1083016767 11:59462217-59462239 TGTTAAAGCCTCACCTAGTCTGG - Intergenic
1083297500 11:61722979-61723001 TGCTGGAGCCTCAGCAGCCCCGG + Intronic
1084147326 11:67272046-67272068 TGCTAAAGCTTTGCCACGCCAGG - Intronic
1084604713 11:70165723-70165745 GGCAAAAGCCACCCCAGGCCAGG + Intronic
1084959427 11:72708676-72708698 GGCCAAAGGCCCACCAGGCCTGG + Intronic
1085858251 11:80200505-80200527 TGCTAAAGCCACAGTAGGGCTGG + Intergenic
1090821892 11:130350035-130350057 TGATAAAGACTCAGAAGGCCAGG - Intergenic
1094162092 12:27402101-27402123 TGCTAAAGCAACACCTGGGCTGG - Intronic
1094305671 12:29016656-29016678 TGGTCTTGCCTCACCAGGCCTGG + Intergenic
1096556191 12:52405510-52405532 TGTTAAAGCCTCATCAGGAAGGG + Intronic
1103454418 12:121053681-121053703 TTCTCAAGCCTCCCGAGGCCAGG + Intergenic
1106915425 13:34508487-34508509 TGATAAAGCATCAGCAGGGCTGG - Intergenic
1109787918 13:67205981-67206003 TGCCAAGGCGTCACCACGCCTGG + Intronic
1112174529 13:97008861-97008883 TGTTAATGCTTCACCAGGCCTGG - Intergenic
1116957647 14:50941432-50941454 AGCTAGAGCCTCACCAAGGCAGG + Intronic
1118688357 14:68313953-68313975 TGCCATAGCCTCTCTAGGCCTGG + Intronic
1121509493 14:94501703-94501725 TGCTGAGACCCCACCAGGCCAGG - Intronic
1122195462 14:100081802-100081824 TCAGAAAGCCTCCCCAGGCCTGG + Intronic
1122454501 14:101839499-101839521 TGGTGAAGCCTCACCAGCTCAGG - Intronic
1122743530 14:103885343-103885365 TGATAAAACCTCATCAGGCTGGG - Intergenic
1123403399 15:20006568-20006590 GGCCTAAGCCTCACCTGGCCTGG - Intergenic
1123512737 15:21013222-21013244 GGCCTAAGCCTCACCTGGCCTGG - Intergenic
1125244143 15:37615025-37615047 TGCTGAAGACTCACCAGCCTAGG + Intergenic
1125501950 15:40245434-40245456 GGCTAGAGCCTCTCCAGGCCAGG - Intronic
1127655105 15:61048367-61048389 CGCTAATGCCTCAGAAGGCCTGG - Intronic
1129161949 15:73752325-73752347 TTCTCAAGCCTCTCCAGGCTCGG + Exonic
1132701667 16:1224752-1224774 TGACCCAGCCTCACCAGGCCGGG - Intronic
1137754593 16:50891435-50891457 TTCTCAAGGCTCACCTGGCCTGG - Intergenic
1139288361 16:65835285-65835307 TGCTAAGGCCTCAGAAGCCCTGG + Intergenic
1139513253 16:67439209-67439231 TGGCAGAGCCTCCCCAGGCCAGG + Intronic
1141789893 16:86227287-86227309 TGCTGAAGCCTCCCTGGGCCTGG + Intergenic
1143604498 17:7974317-7974339 CCTTAAAGCTTCACCAGGCCAGG - Intergenic
1143754090 17:9053908-9053930 TGCTTCAGCCACACCAGGTCAGG + Intronic
1144077794 17:11734578-11734600 GGGCAAAGCCTCTCCAGGCCCGG + Intronic
1146975513 17:37107936-37107958 TTCTACTGCCTCACAAGGCCAGG - Intronic
1147716571 17:42512678-42512700 TGGTAAAGCCACAACAGCCCAGG - Intronic
1148577090 17:48719833-48719855 TGATAAAGCCGCGCGAGGCCCGG + Intergenic
1149808552 17:59642935-59642957 TGCTTAAACATAACCAGGCCAGG - Intronic
1151602357 17:75114016-75114038 TGCTAAAGCCAAGCCAGGGCAGG + Intronic
1152168685 17:78728101-78728123 TGGTAAATCCTCCCCAAGCCAGG + Intronic
1152313549 17:79566288-79566310 TATTTAAGCCTCACCAGGCTGGG + Intergenic
1152447869 17:80356295-80356317 TTCAAAAGCATCAACAGGCCGGG - Intronic
1152940604 17:83170794-83170816 TGATAAAACCTCAACAGGCAAGG + Intergenic
1155724521 18:29062902-29062924 TGCAAAAGCCTCACCTGGGAAGG - Intergenic
1160932892 19:1578888-1578910 AGGAAAACCCTCACCAGGCCAGG + Intronic
1161190748 19:2953912-2953934 TGCAAAAGCCTGGCCAGGCGCGG + Intergenic
1161294106 19:3510976-3510998 TGCTACCGCCTCACCTCGCCTGG + Intronic
1166541463 19:43608484-43608506 AGGTAATGCATCACCAGGCCTGG - Intronic
1167415157 19:49366219-49366241 TGTTAGGGCCTCACCAGGCATGG - Intronic
1167857277 19:52252905-52252927 ACCTAAAGCCACACCAGGCAAGG - Intergenic
927244056 2:20942650-20942672 AGCCAACGCCTCCCCAGGCCAGG - Intergenic
931968777 2:67563138-67563160 AGCGAAAGCCACAGCAGGCCAGG + Intergenic
935733419 2:106085410-106085432 TCCTAAAGCCTCAGCAGGGATGG - Intergenic
938772576 2:134512945-134512967 TGCCACATCCTCACCTGGCCTGG - Intronic
938961249 2:136343559-136343581 TTTTAAAGGCTCCCCAGGCCGGG + Intergenic
941580953 2:167294218-167294240 TGCCAGAGGCGCACCAGGCCGGG - Intergenic
941616640 2:167728089-167728111 TGTCAAAGCTGCACCAGGCCGGG + Intergenic
943743693 2:191438888-191438910 AGTTAAAGCCTCTCCTGGCCAGG + Intergenic
945319558 2:208406450-208406472 GGCTAAAGGCTCCCGAGGCCAGG - Intronic
1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG + Intergenic
1171347993 20:24480188-24480210 TGCTAATGCCACACCAGTGCTGG - Intronic
1173195282 20:40909127-40909149 CCAGAAAGCCTCACCAGGCCTGG + Intergenic
1173213285 20:41054721-41054743 TGCTAAAGACTCACCAGACAAGG - Intronic
1179772824 21:43636076-43636098 TACTTCAGCCTCACCATGCCTGG - Intronic
1182088656 22:27579201-27579223 CACTGAAGCCTCACCAGGCAGGG - Intergenic
1183261918 22:36800658-36800680 AGCCAATGCCTGACCAGGCCTGG + Intergenic
1185095475 22:48803954-48803976 TGCTAGAGCCTCCCCAGGGAAGG + Intronic
1185248420 22:49786000-49786022 TCATGGAGCCTCACCAGGCCGGG - Intronic
950423626 3:12912970-12912992 TCCCTAAGCCTCTCCAGGCCAGG - Intronic
951882638 3:27494374-27494396 AACTAAAGTCTCACCAGGCATGG + Intergenic
955052748 3:55428502-55428524 TGCTAAGGCCTCACCAGCATTGG - Intergenic
957016995 3:75078045-75078067 TACTAGAGCCTTATCAGGCCTGG - Intergenic
958854199 3:99364850-99364872 TGCTGAACCCTGAGCAGGCCTGG + Intergenic
962348208 3:134637853-134637875 TGTTAAAGCCCCTCCAGGGCAGG + Intronic
962789574 3:138798931-138798953 AACAAAAGCCTCACCAAGCCAGG + Intronic
968909275 4:3469372-3469394 TGCAAAAGCCTTCCCTGGCCAGG + Intronic
973339097 4:48986181-48986203 TGCCAGAGCCTGGCCAGGCCGGG - Intergenic
980594946 4:134942232-134942254 TGCAAAAGCCTCACTAAGACTGG - Intergenic
981252697 4:142623336-142623358 TGCTAAGGGTTCACCAAGCCAGG - Intronic
981469317 4:145112005-145112027 TGGTAGACCCTCACCAGACCTGG + Intronic
981838553 4:149083645-149083667 TGATAAAACCTCTCCAGGCAGGG + Intergenic
982380099 4:154740782-154740804 TGCGAATGCGTCACCAGGTCTGG - Intronic
983585424 4:169349039-169349061 TGCTATAGCCTTACTATGCCGGG - Intergenic
988228128 5:28441183-28441205 TGATAAGGCCTCAACAGTCCAGG + Intergenic
990509632 5:56478818-56478840 TTCCAAAGCCTCTCCAGGGCAGG + Intronic
991201743 5:64002612-64002634 TGCTAAATCCTCAACAATCCAGG + Intergenic
1000322499 5:160145969-160145991 AGCTAATGCCTGACCAGGCAGGG + Intergenic
1000916615 5:167089899-167089921 TTCTAAGGACTCACCAGGCAAGG + Intergenic
1002663110 5:180804103-180804125 TGCTAAGGGGTCACCAGGCATGG + Intronic
1005903500 6:30240261-30240283 TGCTAAAGAAACATCAGGCCAGG + Intergenic
1006113610 6:31763473-31763495 TGCTACAGCATGGCCAGGCCTGG + Exonic
1007488313 6:42197923-42197945 TCCTAACGCCTCACTTGGCCTGG + Intergenic
1008609896 6:53176099-53176121 TGCAAAAGGCTAACCAGGGCCGG - Intergenic
1013722913 6:113052613-113052635 TCCTAAAGCCTCAGAAGACCTGG + Intergenic
1015251674 6:131134265-131134287 TTTTAAAGCTTTACCAGGCCGGG - Intergenic
1019197820 6:170292139-170292161 TTCTAAAGCCCCTCCAGCCCCGG + Intergenic
1019416152 7:927356-927378 TGCTCAAGGCTCACCATACCTGG - Intronic
1022517375 7:30984485-30984507 CCCTAGAGCCCCACCAGGCCAGG + Intronic
1026956111 7:74377286-74377308 TGCTAAAGTCTCATTAGGACTGG - Intronic
1030116237 7:106064414-106064436 TGCTGACGCCTCACCACGGCCGG + Intergenic
1035438258 7:158875624-158875646 TGCTTCAGCCTCCCCAGCCCAGG + Intronic
1036168660 8:6461633-6461655 AAATAAAGTCTCACCAGGCCGGG - Intronic
1036656395 8:10679938-10679960 AGCTCCAGCCTCTCCAGGCCAGG - Intronic
1036775105 8:11606260-11606282 TGCAAACGCCACCCCAGGCCAGG + Intergenic
1037075485 8:14711971-14711993 AACTAAAGCTTAACCAGGCCAGG + Intronic
1037605746 8:20435752-20435774 TGCTCCACCCTCACCTGGCCAGG - Intergenic
1038813519 8:30877025-30877047 TCCTAAGGCCTCACCAGCCATGG + Intronic
1042778244 8:72459975-72459997 TGATAAAACCCCACCAGGCAAGG + Intergenic
1049542487 8:143214896-143214918 TGCTGGAGGCTCACCAGGCTAGG + Intergenic
1053011481 9:34636192-34636214 AGATAAAGCCTCACAAGTCCTGG - Intronic
1057613484 9:96567349-96567371 TGCTGCAGCCGCGCCAGGCCCGG + Intronic
1058260998 9:102831525-102831547 TGCTAAAGCCACTCCAGTCTTGG + Intergenic
1060405225 9:123369721-123369743 TTCTAAAGCATCGCCAGGCTGGG - Intronic
1061592043 9:131603906-131603928 AGCCCAAGCCCCACCAGGCCAGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186635913 X:11404755-11404777 TGCTAAATCCTCAGCGAGCCTGG + Intronic
1194074155 X:89367900-89367922 AGACAAAGCCTCAGCAGGCCTGG + Intergenic
1195380978 X:104270508-104270530 CGCTAATTCCTCACCAGTCCCGG + Intergenic
1196143709 X:112294203-112294225 TGCTTAAGCCTCAACAGCCTTGG + Intergenic
1200729547 Y:6719427-6719449 AGACAAAGCCTCAGCAGGCCTGG + Intergenic