ID: 1067685710

View in Genome Browser
Species Human (GRCh38)
Location 10:48465098-48465120
Sequence CTGAACTCCCTCAGCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067685702_1067685710 2 Left 1067685702 10:48465073-48465095 CCTGGCAGGGCCTGCCCCCGCCT 0: 1
1: 0
2: 11
3: 83
4: 688
Right 1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG No data
1067685698_1067685710 24 Left 1067685698 10:48465051-48465073 CCTCATCAGGGTCTCTCAGGAGC 0: 1
1: 0
2: 2
3: 23
4: 202
Right 1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG No data
1067685697_1067685710 25 Left 1067685697 10:48465050-48465072 CCCTCATCAGGGTCTCTCAGGAG 0: 1
1: 0
2: 2
3: 21
4: 180
Right 1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG No data
1067685694_1067685710 29 Left 1067685694 10:48465046-48465068 CCTCCCCTCATCAGGGTCTCTCA 0: 1
1: 0
2: 0
3: 17
4: 199
Right 1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG No data
1067685704_1067685710 -8 Left 1067685704 10:48465083-48465105 CCTGCCCCCGCCTGGCTGAACTC 0: 1
1: 0
2: 4
3: 32
4: 297
Right 1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG No data
1067685696_1067685710 26 Left 1067685696 10:48465049-48465071 CCCCTCATCAGGGTCTCTCAGGA 0: 1
1: 0
2: 1
3: 19
4: 165
Right 1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG No data
1067685693_1067685710 30 Left 1067685693 10:48465045-48465067 CCCTCCCCTCATCAGGGTCTCTC 0: 1
1: 0
2: 1
3: 24
4: 358
Right 1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067685710 Original CRISPR CTGAACTCCCTCAGCTCTCC TGG Intronic
No off target data available for this crispr