ID: 1067686867

View in Genome Browser
Species Human (GRCh38)
Location 10:48470998-48471020
Sequence GCAACCTTGTTAGCTGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067686867_1067686870 4 Left 1067686867 10:48470998-48471020 CCACTACCAGCTAACAAGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1067686870 10:48471025-48471047 CATCCCACCAGGTTGTCCCAAGG No data
1067686867_1067686873 8 Left 1067686867 10:48470998-48471020 CCACTACCAGCTAACAAGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1067686873 10:48471029-48471051 CCACCAGGTTGTCCCAAGGTTGG No data
1067686867_1067686869 -7 Left 1067686867 10:48470998-48471020 CCACTACCAGCTAACAAGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1067686869 10:48471014-48471036 AGGTTGCATTTCATCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067686867 Original CRISPR GCAACCTTGTTAGCTGGTAG TGG (reversed) Intronic
920384382 1:205558483-205558505 GCAATCTTGTTACCTGTTACTGG - Intergenic
922904638 1:229164742-229164764 GCATCCTTGTTAGCCAGCAGGGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1081244468 11:40747050-40747072 GCATCAGTGTTAGCTGGTAAAGG - Intronic
1084019646 11:66409913-66409935 GCAACCTAGTTGGTTGGTCGTGG - Intergenic
1086593519 11:88543837-88543859 GCAACCATGTTATCTGCTATGGG - Intronic
1091112519 11:132983122-132983144 GCAACCTTGCAAGCTGGAGGGGG - Intronic
1092599777 12:10047828-10047850 GGAAACCTTTTAGCTGGTAGAGG + Intronic
1109620371 13:64896568-64896590 ATAACCTTATTAGTTGGTAGAGG - Intergenic
1115475047 14:33805434-33805456 GCAGCCTTGTGAGCTGGAGGTGG + Intergenic
1115957736 14:38799664-38799686 GCAACCTTTTTAGTTTGTTGGGG - Intergenic
1116473589 14:45313977-45313999 GCTACCTTGTTCCCTGGAAGTGG + Intergenic
1119009764 14:70972483-70972505 GCATACTTGTTAGCTGCTTGGGG + Intronic
1140838658 16:78818721-78818743 GCAAGCTAGTTACATGGTAGAGG - Intronic
1142327265 16:89423954-89423976 ACAACCTTGTAAGCGGGTAAGGG + Intronic
1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG + Intronic
1147375476 17:40020181-40020203 GAGACCTTGTCAGCTGGAAGGGG - Intronic
1151461428 17:74256443-74256465 GCAGGCTTGCTAGCAGGTAGAGG - Intronic
1152484792 17:80583524-80583546 GGGACCTTGTGAGCTGGTGGAGG + Intronic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1159995225 18:74957939-74957961 GCTTCCTTGTTACCTGGCAGAGG + Intronic
1162419055 19:10555443-10555465 GCAACCCTGCTGGGTGGTAGCGG - Intronic
931349993 2:61479139-61479161 GCAAACCTGTTAACTGGTGGGGG + Intronic
940498928 2:154470141-154470163 GAAAACATGTTAGATGGTAGAGG - Intergenic
942700825 2:178707901-178707923 GCAACAGTGTTACCTGTTAGAGG - Intronic
1169061785 20:2665648-2665670 GCCACCTTTTTGGCTGGTTGAGG - Intergenic
1170701238 20:18705529-18705551 GGTACCATGGTAGCTGGTAGTGG + Intronic
1179887346 21:44319808-44319830 GCCACCTTGGTAGCGGGTGGAGG - Intronic
1182855113 22:33510226-33510248 GCCACCTTGTAAGGGGGTAGTGG + Intronic
950581799 3:13867160-13867182 CCCACCTTGCTAGGTGGTAGTGG - Intronic
954105313 3:48406698-48406720 GCAGCCCTGTGAGCTGGTTGGGG - Intronic
954214456 3:49116720-49116742 GCAACCTTGGTGGATGGTAAAGG - Exonic
962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG + Intronic
964777375 3:160293009-160293031 GCAGCTTTATTGGCTGGTAGCGG + Intronic
964948847 3:162262062-162262084 TTAACCTTTTTTGCTGGTAGAGG - Intergenic
966448902 3:180036173-180036195 GCAACCTTTTCAGATGGTAAAGG + Intronic
967752010 3:193125852-193125874 GCAACCTTATTATCTGGTGCAGG + Intergenic
968954739 4:3712451-3712473 GAAACCTTGGTAGCTGGTGCTGG + Intergenic
969597437 4:8157396-8157418 CCAACCTAGTTATCTGGGAGTGG - Intronic
971047505 4:22821659-22821681 GCAACCTTGGTATTTGGCAGTGG + Intergenic
980021936 4:127721304-127721326 GAAACCTTATAAGCTGGAAGAGG - Exonic
987732134 5:21787351-21787373 GTAATCTTGTTTGCTGGTAGAGG - Intronic
995259760 5:110089481-110089503 GCAACCTTCTTAGAAGGTAGTGG - Intergenic
995820802 5:116229557-116229579 GCAACACTGTTAGCTGCTAAAGG + Intronic
1000703185 5:164478296-164478318 GCAACTATGTAAGTTGGTAGAGG + Intergenic
1001617977 5:173057291-173057313 GCAGCCATGTTAGATGGGAGGGG + Intronic
1010512642 6:76739499-76739521 GAAACCTTGTAAGCTGTTGGTGG + Intergenic
1010516975 6:76785256-76785278 GCAGCCATGTCAGCTGGTTGTGG - Intergenic
1019897398 7:3993207-3993229 GCAACCTTGATATTTGGGAGAGG + Intronic
1028455164 7:91030630-91030652 GCAAGCCTGTCACCTGGTAGAGG + Intronic
1030698687 7:112615050-112615072 GCAGCCTTGGAAGCAGGTAGTGG - Intergenic
1035627722 8:1084979-1085001 GGAACCCTGTTCGCTGTTAGTGG - Intergenic
1036691655 8:10948392-10948414 GCAGCCTTCTCAGCTGGCAGAGG - Intronic
1041373637 8:57190742-57190764 GCAAGCGTGTGAGCTGGTGGGGG + Intergenic
1042579393 8:70260040-70260062 GTAACTTTGTTTCCTGGTAGTGG - Intronic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1046952612 8:120032585-120032607 GTGACCTTGTTGGCTGGTGGGGG + Intronic
1049432675 8:142572477-142572499 TCAGCCTTGTGAGCTGGTGGTGG - Intergenic
1051180236 9:14404219-14404241 GCATTTTTGATAGCTGGTAGGGG - Intergenic
1052591798 9:30506265-30506287 GCAATCTTTTTTGCTGGTGGAGG + Intergenic
1057926047 9:99150714-99150736 GCACCCTTGTTACTTGGGAGAGG + Exonic
1060709939 9:125851199-125851221 GCAAATTTATTAGCTGATAGAGG - Intronic
1060941261 9:127544363-127544385 GCAACCTTGTGAGGTGGTGGTGG - Intronic
1188106618 X:26155182-26155204 GTAACCTTTTTTGCTGGTGGAGG + Intergenic
1188620098 X:32210127-32210149 TCAAAGTTATTAGCTGGTAGTGG - Intronic
1188665356 X:32812753-32812775 ATAAGCTTGTTAGCTGTTAGGGG - Intronic
1192594488 X:72392268-72392290 GCCACCTGGTAAGCTGGCAGGGG - Intronic
1194723135 X:97364079-97364101 GCAACATGGCTAGCTGATAGAGG + Intronic
1197280689 X:124532121-124532143 GCCACCTTGTTAACTGGTGGAGG - Intronic
1199075937 X:143526102-143526124 GCAAACTTGGTAGGTGGTATGGG + Intergenic