ID: 1067686869

View in Genome Browser
Species Human (GRCh38)
Location 10:48471014-48471036
Sequence AGGTTGCATTTCATCCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067686865_1067686869 7 Left 1067686865 10:48470984-48471006 CCATCAAATGATGACCACTACCA 0: 1
1: 1
2: 2
3: 6
4: 111
Right 1067686869 10:48471014-48471036 AGGTTGCATTTCATCCCACCAGG No data
1067686864_1067686869 25 Left 1067686864 10:48470966-48470988 CCTTTTAGAGATGTCATTCCATC 0: 1
1: 0
2: 4
3: 20
4: 172
Right 1067686869 10:48471014-48471036 AGGTTGCATTTCATCCCACCAGG No data
1067686867_1067686869 -7 Left 1067686867 10:48470998-48471020 CCACTACCAGCTAACAAGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1067686869 10:48471014-48471036 AGGTTGCATTTCATCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067686869 Original CRISPR AGGTTGCATTTCATCCCACC AGG Intronic
No off target data available for this crispr