ID: 1067686870

View in Genome Browser
Species Human (GRCh38)
Location 10:48471025-48471047
Sequence CATCCCACCAGGTTGTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067686865_1067686870 18 Left 1067686865 10:48470984-48471006 CCATCAAATGATGACCACTACCA 0: 1
1: 1
2: 2
3: 6
4: 111
Right 1067686870 10:48471025-48471047 CATCCCACCAGGTTGTCCCAAGG No data
1067686868_1067686870 -2 Left 1067686868 10:48471004-48471026 CCAGCTAACAAGGTTGCATTTCA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1067686870 10:48471025-48471047 CATCCCACCAGGTTGTCCCAAGG No data
1067686867_1067686870 4 Left 1067686867 10:48470998-48471020 CCACTACCAGCTAACAAGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1067686870 10:48471025-48471047 CATCCCACCAGGTTGTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067686870 Original CRISPR CATCCCACCAGGTTGTCCCA AGG Intronic
No off target data available for this crispr