ID: 1067686873

View in Genome Browser
Species Human (GRCh38)
Location 10:48471029-48471051
Sequence CCACCAGGTTGTCCCAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067686865_1067686873 22 Left 1067686865 10:48470984-48471006 CCATCAAATGATGACCACTACCA 0: 1
1: 1
2: 2
3: 6
4: 111
Right 1067686873 10:48471029-48471051 CCACCAGGTTGTCCCAAGGTTGG No data
1067686867_1067686873 8 Left 1067686867 10:48470998-48471020 CCACTACCAGCTAACAAGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1067686873 10:48471029-48471051 CCACCAGGTTGTCCCAAGGTTGG No data
1067686868_1067686873 2 Left 1067686868 10:48471004-48471026 CCAGCTAACAAGGTTGCATTTCA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1067686873 10:48471029-48471051 CCACCAGGTTGTCCCAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067686873 Original CRISPR CCACCAGGTTGTCCCAAGGT TGG Intronic
No off target data available for this crispr