ID: 1067690268

View in Genome Browser
Species Human (GRCh38)
Location 10:48497294-48497316
Sequence CAGCTCTGTCTCCTTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067690262_1067690268 -2 Left 1067690262 10:48497273-48497295 CCCAGGGTAGGCCTTGGGCCACA 0: 1
1: 0
2: 3
3: 17
4: 183
Right 1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG No data
1067690261_1067690268 -1 Left 1067690261 10:48497272-48497294 CCCCAGGGTAGGCCTTGGGCCAC 0: 1
1: 0
2: 3
3: 12
4: 188
Right 1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG No data
1067690256_1067690268 12 Left 1067690256 10:48497259-48497281 CCTGACCTTGTCTCCCCAGGGTA No data
Right 1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG No data
1067690258_1067690268 7 Left 1067690258 10:48497264-48497286 CCTTGTCTCCCCAGGGTAGGCCT 0: 1
1: 1
2: 1
3: 32
4: 235
Right 1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG No data
1067690253_1067690268 30 Left 1067690253 10:48497241-48497263 CCTGAAGGAGAGCAGGATCCTGA 0: 1
1: 0
2: 0
3: 32
4: 214
Right 1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG No data
1067690263_1067690268 -3 Left 1067690263 10:48497274-48497296 CCAGGGTAGGCCTTGGGCCACAG 0: 1
1: 0
2: 0
3: 21
4: 227
Right 1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067690268 Original CRISPR CAGCTCTGTCTCCTTGGCAT GGG Intronic
No off target data available for this crispr