ID: 1067693456

View in Genome Browser
Species Human (GRCh38)
Location 10:48519277-48519299
Sequence CTGGGCAGGAATGCTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067693456_1067693464 7 Left 1067693456 10:48519277-48519299 CCAGCAACAGCATTCCTGCCCAG 0: 1
1: 0
2: 0
3: 27
4: 280
Right 1067693464 10:48519307-48519329 GGCCTCTGTACTCTGGCTGCTGG No data
1067693456_1067693465 8 Left 1067693456 10:48519277-48519299 CCAGCAACAGCATTCCTGCCCAG 0: 1
1: 0
2: 0
3: 27
4: 280
Right 1067693465 10:48519308-48519330 GCCTCTGTACTCTGGCTGCTGGG No data
1067693456_1067693462 0 Left 1067693456 10:48519277-48519299 CCAGCAACAGCATTCCTGCCCAG 0: 1
1: 0
2: 0
3: 27
4: 280
Right 1067693462 10:48519300-48519322 GTCCACTGGCCTCTGTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067693456 Original CRISPR CTGGGCAGGAATGCTGTTGC TGG (reversed) Intronic
900402174 1:2477058-2477080 CTGGGCTGGCATCCTGGTGCCGG + Intronic
900476300 1:2877945-2877967 CTGGGCAGGAATGGGGTTCACGG + Intergenic
900630806 1:3634177-3634199 CTGGGCAGAAAGGGTGTTTCAGG - Intronic
901419026 1:9137714-9137736 CCAGGCTGGAATGCTGTGGCAGG + Intergenic
902268932 1:15289312-15289334 TTGGGCAGCAATGCTGTGGCTGG + Intronic
902669971 1:17966445-17966467 CTGGGGAGAAATGGTGTTTCAGG - Intergenic
902743576 1:18457793-18457815 CTGGGCATGACTGCTGGAGCTGG + Intergenic
903202673 1:21755242-21755264 CTGGCCTGCAATGCTTTTGCAGG - Intronic
905239775 1:36573959-36573981 CTGAGCACCAATGCTGTTCCAGG - Intergenic
906195860 1:43930488-43930510 CTGGGCAGCAAGGCTGCTGCCGG + Exonic
906551005 1:46666442-46666464 CTGGGCAGTGAAGCTGTTGCTGG + Intronic
907406280 1:54255392-54255414 CTGGGTGGGAAGGCTGCTGCTGG + Intronic
908381280 1:63599207-63599229 CTAGGCTGGAGTGCAGTTGCAGG + Intronic
909875329 1:80795581-80795603 CTGGCCAGGAGTGATGGTGCAGG + Intergenic
910410203 1:86934882-86934904 CCAGGCAGGAATGCAGTGGCAGG - Intronic
911353967 1:96793411-96793433 CTGGGCTGGAGTGCAGTGGCGGG + Intronic
911935449 1:103963962-103963984 CCAGGCTGGAATGCTGTGGCGGG - Intergenic
914339612 1:146748880-146748902 CTGGGCAGGAGTGGTATTTCTGG + Intergenic
916425176 1:164673512-164673534 CTGGGCTGGAGTGCAGTGGCGGG + Intronic
918215146 1:182386856-182386878 CCAGGCAGGAAGGCTGTTACTGG + Intronic
919662073 1:200257142-200257164 CTGGGACGGGATGCTTTTGCAGG - Intergenic
922167897 1:223130929-223130951 CAGGGCATCAATGCTGTTGGTGG + Intronic
923171507 1:231421657-231421679 CGGGGCCGGAATGCTGGTGTGGG + Exonic
924446638 1:244138741-244138763 CTGGGCATGGGTGATGTTGCTGG - Intergenic
1062992252 10:1831243-1831265 CTCGGCAGGAATGCAGGTGTGGG + Intergenic
1063099884 10:2940918-2940940 CTGGGCAGGAGTGTTGTTAGTGG - Intergenic
1063191760 10:3701680-3701702 TTGGGCAGGAATGCTGACCCAGG + Intergenic
1063543999 10:6962274-6962296 CAGGGCAGGAGTGCTTCTGCTGG - Intergenic
1063608605 10:7544161-7544183 CTGGGAAGGAAGGCCGTGGCAGG + Intergenic
1065038913 10:21671067-21671089 CTGGGCTGGAGTGCAGTGGCCGG + Intronic
1065207181 10:23368291-23368313 TTGGGCAGGACAGCTGTTTCAGG - Intergenic
1065214198 10:23434768-23434790 CTGGGCTGGAAGGCAGTGGCAGG + Intergenic
1065285594 10:24184642-24184664 ATGGGCTGGAATCCTGCTGCTGG - Intronic
1066427265 10:35319004-35319026 CTGGGCCGGAGTGCAGTGGCGGG + Intronic
1066690145 10:38018360-38018382 TTGGGCAGGAATGTGGTTGGTGG + Intronic
1067693456 10:48519277-48519299 CTGGGCAGGAATGCTGTTGCTGG - Intronic
1069599205 10:69692636-69692658 CTGGGCAGGAAGGGTGATGAGGG + Intergenic
1069599436 10:69693927-69693949 CTGGGCAGGAAGGGTGATGAGGG - Intergenic
1069787541 10:70998302-70998324 CAGGACAGGGATGCTGTGGCAGG + Intergenic
1070110874 10:73485782-73485804 CGGGGCTGGAATGCAGTGGCAGG + Intronic
1070924151 10:80207214-80207236 CTGGGCAGGTGTGCTGGTGCCGG + Intergenic
1072067244 10:91883238-91883260 TTGGGCAGGAATGCAGTGGCAGG - Intergenic
1074825932 10:117215968-117215990 CTGGGCAGGGATGCTGAAGCGGG + Intergenic
1076032711 10:127173121-127173143 CTGGCCAGCAATGCTGGAGCAGG - Intronic
1076048100 10:127311160-127311182 CTTGGTAGAAATGCAGTTGCAGG - Intronic
1077382203 11:2249454-2249476 CTGGGCTGGAATTCTTGTGCAGG - Intergenic
1078479466 11:11663462-11663484 CTAGGCAGGAAGGCTGAGGCAGG + Intergenic
1080166310 11:29241922-29241944 CTGTACAGGAATCCTGATGCTGG + Intergenic
1080570046 11:33547436-33547458 CTGTCCATGAATGTTGTTGCAGG + Intronic
1081568429 11:44275066-44275088 AGGGGCAGGAAGGCTGCTGCTGG - Intronic
1084071587 11:66739986-66740008 CTGGGCTGGAGTGCAGTGGCAGG - Intergenic
1084482902 11:69432369-69432391 ATGGGCAGGGCCGCTGTTGCTGG - Intergenic
1084605584 11:70169919-70169941 CTGAGCAGGAAAGCTGGTTCGGG - Intronic
1085596778 11:77818733-77818755 CCAGGCAGGAATGCAGTGGCAGG - Intronic
1087356273 11:97098164-97098186 CTGTGCAGAGATCCTGTTGCAGG + Intergenic
1088159571 11:106854011-106854033 TTGGGCATGAGTGATGTTGCTGG + Intronic
1088255912 11:107903500-107903522 CTGGGCTGGAGTGCAGTGGCAGG + Intronic
1089160369 11:116432545-116432567 ATGGGTTGGCATGCTGTTGCGGG - Intergenic
1089559722 11:119337777-119337799 CTGGGCTGGAGTGCGGCTGCGGG + Intergenic
1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG + Intergenic
1089870690 11:121670282-121670304 CTGTACAGGAATGAGGTTGCAGG - Intergenic
1090056995 11:123431896-123431918 CTGGTCAGGACTGCTGCTTCAGG + Intronic
1090331400 11:125935243-125935265 CTGGTCAGGGATGCTGTAGAGGG + Intergenic
1091777386 12:3193389-3193411 TGGGGCAGGATTGCTGTAGCTGG + Intronic
1091913030 12:4247011-4247033 CTGGGCTTAAATGCTGGTGCTGG + Intergenic
1092742913 12:11648198-11648220 GTGGGAAAGAGTGCTGTTGCTGG - Intergenic
1095847661 12:46763274-46763296 CTGTGCAGGAATTATGATGCTGG + Intergenic
1097806217 12:63967610-63967632 CTGGGCAGGAATGGGCTTGGGGG + Intronic
1097970907 12:65632210-65632232 CTCAGCAGCAATGCTGCTGCTGG + Intergenic
1098486677 12:71029482-71029504 CAGGGCTGGCATGCTGGTGCTGG - Intergenic
1102699644 12:114827702-114827724 TTGGGCAGGGATGATGTTGATGG + Intergenic
1103688000 12:122747759-122747781 CTGGGAAGAACTGATGTTGCTGG - Intergenic
1103983377 12:124751116-124751138 CTTGCGAGGAAAGCTGTTGCTGG - Intergenic
1104011174 12:124931310-124931332 CTGGGCTGGAGTGCAGTAGCAGG + Intergenic
1104395427 12:128428281-128428303 CAGGGCATGAATGATGTTCCTGG + Intronic
1104407367 12:128529257-128529279 CTAGGCAAGAATGCTGATGGGGG - Intronic
1104447176 12:128844066-128844088 CCAGGCTGGAATGCTGTGGCGGG - Intergenic
1105772878 13:23629739-23629761 CGGGGCAGGTATCATGTTGCTGG - Intronic
1106180314 13:27364036-27364058 TTGTGGATGAATGCTGTTGCTGG + Intergenic
1106521459 13:30501392-30501414 CTGGGCTGGAGTGCAGTGGCTGG + Intronic
1106652628 13:31708137-31708159 CCTGTCAGGAATGATGTTGCAGG + Intergenic
1106659452 13:31783701-31783723 CTGGGCAGGAATGCCCTGGGAGG - Intronic
1107803273 13:44130773-44130795 GTGGGCAAGAATGCTGGTGGTGG - Intergenic
1109277934 13:60322796-60322818 CTGGGCAGGGAGGGTGTTCCTGG - Intergenic
1114382060 14:22217103-22217125 TTGGGTAGTAGTGCTGTTGCTGG - Intergenic
1115231705 14:31167403-31167425 CTGGGCTGGAGTGCAGTGGCTGG - Intronic
1116837019 14:49778765-49778787 CTGGGCTGGAGTGCAGTGGCGGG + Intronic
1117708306 14:58497016-58497038 CCAGGCAGGAATGCAGTGGCGGG + Intronic
1119051313 14:71371679-71371701 CTGGCCAGGCACGGTGTTGCAGG - Intronic
1119447810 14:74681140-74681162 CTAGGCTGGAATGCAGTGGCAGG - Intronic
1119681683 14:76597032-76597054 CTGGGGAGGATGGCTGGTGCTGG + Intergenic
1120781482 14:88489945-88489967 CTGGGAAGGAATACTGATGGAGG + Intronic
1121360136 14:93249546-93249568 ATGGGCAGGCATGCTGTGACTGG + Intronic
1122239045 14:100349723-100349745 CTGGGCAGGAAGGCCGTTCTGGG + Intronic
1123765844 15:23477806-23477828 CTGGGCAACAAAGCTGTTGCAGG - Intergenic
1124027789 15:25982875-25982897 CTGGGATGGAATGCTGTGGAGGG - Intergenic
1125422646 15:39519914-39519936 CTGGGTAGGAACGCTGCTGCTGG - Intergenic
1127637892 15:60888823-60888845 CTGGGCAGGAGGCCTGCTGCTGG - Intronic
1128550651 15:68596075-68596097 TTGTGCAGGAGTGCTGTTCCTGG + Intronic
1129121379 15:73398962-73398984 CTGGCCCGGAATGCAGTTGCTGG + Intergenic
1129825025 15:78629217-78629239 CTGGGCGGGAAGGCTCTGGCCGG + Exonic
1130455184 15:84098877-84098899 CTGTCCCTGAATGCTGTTGCAGG + Intergenic
1130605978 15:85317354-85317376 CCGGGCTGGAATGCAGTGGCAGG + Intergenic
1131310257 15:91284165-91284187 CAGGGCAGAAATGATGTTCCCGG - Exonic
1132175459 15:99710680-99710702 CTCGCCAGGAATGCTGTCGCTGG + Exonic
1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG + Intronic
1132748771 16:1447762-1447784 CTGCGCTGGAATGCTGTGTCGGG + Intronic
1133545411 16:6801634-6801656 TTGGGCAGGAAAGGTGTTTCTGG + Intronic
1134012997 16:10868959-10868981 GTGGGCAGGTGTGCTGCTGCTGG + Intergenic
1137634384 16:49973344-49973366 ATGGGCAGGTAGGCTGGTGCTGG - Intergenic
1138972583 16:62163578-62163600 CCGGGCTGGAATGCAGTGGCAGG - Intergenic
1139357603 16:66376612-66376634 CCAGGCAGAAGTGCTGTTGCTGG - Intronic
1139994674 16:70968528-70968550 CTGGGCAGGAGTGGTATTTCTGG - Intronic
1140069318 16:71635283-71635305 CTGGGCTGGAGTGCAGTGGCGGG - Intronic
1141588284 16:85049707-85049729 CTGGGCAGGAAGCATGATGCTGG - Intronic
1142686643 17:1580989-1581011 CTGCCCAGGAAGGCTGCTGCTGG + Intronic
1143156982 17:4843857-4843879 CTGGGCTGCCATGCTGTTGGAGG + Intronic
1143832850 17:9666212-9666234 GTGGGCAGGAATGATTTAGCAGG + Intronic
1144359096 17:14474661-14474683 TTAGGCATGAATGCTGTGGCAGG + Intergenic
1144763036 17:17718066-17718088 CTGCACAGGAATGCTGGTGCTGG - Intronic
1145359240 17:22198588-22198610 CTGGGCTGGAGTGCGGTGGCAGG + Intergenic
1145758262 17:27408667-27408689 CTTGGCAGGAATGCCTTTGGAGG - Intergenic
1145919334 17:28598845-28598867 CTGGGCCGGGCTGCTGTCGCGGG - Intronic
1147501248 17:40965924-40965946 CTGGGCTGGAGTGCAGTGGCAGG + Intronic
1148063536 17:44852639-44852661 CTGGGCTGGAATGCATTTGGGGG - Intronic
1148696804 17:49565264-49565286 CTGGGCTGGAGTGCGGTGGCGGG - Intergenic
1149863676 17:60138755-60138777 CTGGTCCAGAAGGCTGTTGCGGG + Intergenic
1149949858 17:60973932-60973954 GTTGGAGGGAATGCTGTTGCTGG + Intronic
1150756354 17:67917853-67917875 CTAGGCTGGAATGCAGTGGCCGG + Intronic
1151363729 17:73604093-73604115 CTGGCCAGGAAGGCTGACGCTGG - Intronic
1151744874 17:76006664-76006686 CGGGGCAGGGATGCAGTGGCAGG - Intronic
1151999675 17:77637458-77637480 GTGGGCGGGAGCGCTGTTGCTGG + Intergenic
1152790683 17:82277412-82277434 CTGGGCTGGAGTGCAGTGGCAGG - Intergenic
1154299962 18:13184341-13184363 CTGGGGAGAAAGGCTGTGGCTGG + Intergenic
1155450801 18:25960683-25960705 CAGGGCAGTAATGCTGTACCTGG - Intergenic
1156457468 18:37302835-37302857 CTAGGAAGCAATGCTGTTGGAGG - Intronic
1157979342 18:52362940-52362962 CTGGGCTGGAGTGCAGTGGCGGG + Intronic
1158767232 18:60467448-60467470 CTGAGAAGGAAAACTGTTGCTGG + Intergenic
1159144109 18:64431332-64431354 CTGGGCATGAATGATGATGATGG - Intergenic
1160342320 18:78100333-78100355 CTGGGAAGAGATGCTTTTGCAGG - Intergenic
1161456835 19:4373810-4373832 CTGGCCAGGAAGTCTGTGGCAGG - Intronic
1162196333 19:8987882-8987904 CTAGGCTGGAATGCAGTGGCGGG + Intergenic
1162842526 19:13366816-13366838 CTGGGTAGGAAAGCGGTTGGCGG + Intronic
1163270216 19:16248551-16248573 TTGGGCAGCAATGGTGTGGCAGG - Intergenic
1164527383 19:29022203-29022225 CAGTGCAGGAATGCTGTTTTGGG + Intergenic
1164869540 19:31631675-31631697 CTGGGCAGGGATGATGGTGAAGG - Intergenic
1167898897 19:52603502-52603524 CTGGGCTGGAGTGCAGTGGCAGG - Intronic
1167926937 19:52828902-52828924 CCAGGCTGGAATGCTGTGGCAGG + Intronic
1168310583 19:55458123-55458145 CTGGCCAGCAATTCTTTTGCAGG + Intronic
1168537645 19:57184594-57184616 CTGGGCTGGAGTGCAGTGGCAGG + Intergenic
1168723366 19:58567315-58567337 CTGGGCAGGGCTGCTGCTGTGGG + Intronic
925265515 2:2563841-2563863 GGGGGCAGGAACGCTGTTTCTGG + Intergenic
926655346 2:15398185-15398207 CTAGGCTGGAATGCAGTGGCAGG + Intronic
927930292 2:27039529-27039551 GTGTGCAGGAATGCAGCTGCCGG - Intronic
928517211 2:32054813-32054835 CTGGGCATGAAAGCTGAGGCAGG + Intergenic
928603927 2:32926851-32926873 CAGGGGAGGAATGCTGATGGGGG - Intergenic
930060270 2:47282793-47282815 CTGTGCAGGACTGCTGTCTCTGG + Intergenic
932416514 2:71576669-71576691 CAGGGCAGGAAGGCTGGAGCGGG + Intronic
935034339 2:99354043-99354065 ATGTGCAAGAATGCAGTTGCTGG + Intronic
935126439 2:100227623-100227645 CTGGGCAGGATCCCTCTTGCTGG - Intergenic
936114249 2:109689302-109689324 CTGCCCAGGCATGCTGTTGTGGG - Intergenic
936399822 2:112156589-112156611 CTGGGCAGGTACGGGGTTGCAGG + Intronic
937409528 2:121660985-121661007 CTAGGCAGGAGTGCAGTGGCGGG - Intergenic
938041421 2:128079267-128079289 CTGGGCTGGAGTGCTGTGGTGGG + Intergenic
938765888 2:134460263-134460285 GAGGGCAGGATGGCTGTTGCAGG - Intronic
938787754 2:134648032-134648054 CTGGACAAGAATTCAGTTGCAGG - Intronic
938876067 2:135532056-135532078 CTTGGCAGGCCTGCTGTGGCTGG - Intronic
941778907 2:169423324-169423346 CTAGGCAGGAGTGCAGTGGCGGG - Intergenic
942914716 2:181291228-181291250 CTGAGCAGGAATGCTGTGGGTGG + Intergenic
944780734 2:203014701-203014723 CTGCGCAGGTATGCTGGGGCGGG + Intronic
944929097 2:204497924-204497946 GTGGGTAAGAATGTTGTTGCTGG + Intergenic
945538367 2:211049468-211049490 CTGGGCAGAGCTGCTGCTGCTGG + Intergenic
946084210 2:217154834-217154856 CTGGGCAGCAGTGCTGGTGGTGG - Intergenic
947424207 2:229968509-229968531 CCAGGCTAGAATGCTGTTGCAGG + Intronic
948202189 2:236137228-236137250 CCGGGCAAGAAGGCTGCTGCTGG - Intergenic
1170892418 20:20387306-20387328 CCGGGCTGGAGTGCTGTGGCAGG - Intergenic
1171341201 20:24431087-24431109 TTGGGCTGGAAGGCTGTTGGGGG - Intergenic
1171431486 20:25085602-25085624 CTGGGCAGGCGTGCAGTTGGAGG - Intergenic
1172367111 20:34358595-34358617 CCAGGCAGGAATGCAGTGGCAGG + Intergenic
1172673027 20:36647414-36647436 CTGAGCAGGAGTGCTGTAGCTGG - Intergenic
1172768111 20:37361763-37361785 CAGGGCAGGAGTGCTGCTGAGGG + Intronic
1172946255 20:38692023-38692045 CTGGGCTGGAGTGCAGTGGCAGG + Intergenic
1173083282 20:39890226-39890248 CATGGCAGGGATGTTGTTGCAGG + Intergenic
1175712394 20:61231672-61231694 CTAGGCAGGAGGTCTGTTGCTGG - Intergenic
1175815917 20:61883147-61883169 CTCGGGAGGAATGCTGTAGGCGG - Intronic
1176054785 20:63139064-63139086 ATGCCCAGGAATGCAGTTGCGGG - Intergenic
1176122566 20:63460676-63460698 CTGGCCAGGAAGGCTGGTGAGGG - Intronic
1176970154 21:15255775-15255797 CTGGGCTGGAGTGCAGTGGCAGG - Intergenic
1177407012 21:20682832-20682854 CTGGGCAGGAATGAAATTACTGG - Intergenic
1178374741 21:32057376-32057398 GTGGGCAGGAAAGCTTGTGCAGG + Intergenic
1178448447 21:32667614-32667636 CAGGGCTGGAGTGCTGTGGCAGG + Intronic
1179551449 21:42146435-42146457 CTGGGGAGGAAGGCTGTGGTGGG + Intergenic
1180877272 22:19180442-19180464 CTGGACAGCAAGGCTGCTGCTGG - Intronic
1181370077 22:22408928-22408950 CTGCCCAGGAATGCTCTTCCTGG - Intergenic
1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG + Intronic
1184475796 22:44720628-44720650 CTGGCCAGGAATGCTGCCGAAGG - Intronic
949892713 3:8745285-8745307 CTGTGCAGGAATCATGGTGCTGG - Intronic
951104820 3:18730511-18730533 CTGGGTATAAATGATGTTGCTGG - Intergenic
952986544 3:38790366-38790388 CTGGACAGAAAAGCTGTTGAGGG - Intronic
953172708 3:40522645-40522667 CTGGGCTGGAGTGCAGTGGCGGG + Intergenic
953576349 3:44115942-44115964 CTGGGCAGGAACTATGTTACAGG + Intergenic
954230067 3:49210070-49210092 CTGGGCTGGAATGCAGTGGTGGG + Intronic
954544374 3:51420211-51420233 CTGGGCAGCCATGCTGCTGTGGG - Exonic
955006383 3:54972671-54972693 CTTGGCAGGAGTGCTGTGGCTGG + Intronic
955073177 3:55588833-55588855 GTGTGCAGGATTGCTGTAGCTGG - Intronic
955561157 3:60192373-60192395 CTCAGCATGAATGCTGTGGCTGG + Intronic
962301563 3:134248282-134248304 ATGCCCAGAAATGCTGTTGCTGG - Intronic
963141188 3:141947456-141947478 CTGGGCTGGAGTGCAGTGGCGGG + Intergenic
966563687 3:181352012-181352034 CTGGACAGGAATTGTGGTGCTGG - Intergenic
968658326 4:1788058-1788080 CTTGGCAGGAAGGCTGGTGCTGG + Intergenic
968918363 4:3508522-3508544 CTGTGTAGGAATGCTCTTGAGGG - Exonic
968958966 4:3733252-3733274 CTGGGCAGAGATGCTGCTTCAGG + Intergenic
970458624 4:16250808-16250830 CTGGCAAGGAATGCTGTTACAGG + Intergenic
971494556 4:27250345-27250367 CTGTGCAGGAAGCATGTTGCTGG + Intergenic
974558543 4:63486487-63486509 CTGGGAAGGAATGATCTTGTAGG - Intergenic
975342822 4:73259766-73259788 CTCGGAAGGAATGCTGTTATGGG + Intergenic
975620468 4:76291311-76291333 CTGGGCATGGATGCTGCTGCTGG - Intronic
977277528 4:94996253-94996275 CTGGGTAAGAATGTTGTTGGTGG + Intronic
977531742 4:98208227-98208249 CTGGGCTGGAATGCAGTGGCTGG - Intergenic
978269153 4:106868082-106868104 CTTGGCAGAAAAGCTATTGCTGG + Intergenic
979139414 4:117153190-117153212 CTGTGCAGAAATCCTGTTGTAGG - Intergenic
979913768 4:126404698-126404720 CTGTGCAGGGATCCTGATGCAGG + Intergenic
984574007 4:181426212-181426234 CCAGGCTGGAATGCTGTGGCTGG - Intergenic
985511286 5:315627-315649 CTGGGCAGGTGTGCTGTGGGGGG + Intronic
985826177 5:2193237-2193259 CTGGCCAGGACTCCTGGTGCAGG + Intergenic
989647659 5:43653102-43653124 CTGGGCATGATTGGGGTTGCTGG + Exonic
990806793 5:59672134-59672156 CTGGCTAGGCATGCTGTTACTGG - Intronic
993486889 5:88497779-88497801 CTGGGTATGAGTGCTGATGCAGG - Intergenic
996550133 5:124721828-124721850 CTCGGAAGGAAGGCTGTAGCAGG + Intronic
997228006 5:132223962-132223984 CTGGGCAGGCATGTTCTTCCTGG - Intronic
997372412 5:133370450-133370472 CTGGGCAGGAAGCCTGCTGGAGG + Intronic
998073288 5:139216051-139216073 CTAGGCAGGAATGCAGTAGCAGG - Intronic
998367571 5:141640862-141640884 CGGGGCAGGCAGCCTGTTGCAGG - Exonic
999178810 5:149654288-149654310 AGGGGCAGGAGTGCTGGTGCAGG + Intergenic
999277333 5:150339918-150339940 CCAGGCAGGAATGCAGTGGCAGG - Intergenic
1000611746 5:163382685-163382707 CTTGGGAGGGTTGCTGTTGCTGG - Intergenic
1000914839 5:167068263-167068285 CTGGGCACTAATGCTGTTTAAGG - Intergenic
1001275887 5:170351241-170351263 CTGGCCAGGAATCCTGCTGGAGG - Intergenic
1002098285 5:176844850-176844872 CTGGGCAGGGAGTCTGTGGCTGG - Intronic
1002586702 5:180253131-180253153 CCGGGCAGGGATGCTGAGGCAGG + Intronic
1003123070 6:3333856-3333878 CTGTGCAGTAATTCTGATGCTGG + Intronic
1003325929 6:5090732-5090754 CTGAGCAGGAAGGCTGTGGGCGG - Intergenic
1003677377 6:8217973-8217995 CTGGGCTGGAGTGCAGTGGCAGG + Intergenic
1003996920 6:11551022-11551044 ATGGTCAGGAATGCTGGTTCTGG + Intronic
1007246036 6:40463532-40463554 CTGGGCAGGAATGTGGTTGTGGG - Intronic
1007770915 6:44191779-44191801 CTAGGCTGGAATGTAGTTGCGGG + Intergenic
1010140953 6:72614066-72614088 CTGGGCTGGACTGCAGTGGCAGG + Intergenic
1010147808 6:72692382-72692404 CATGGAAGGAATGCTGCTGCAGG - Intronic
1015592530 6:134836072-134836094 CCAGGAAGGAATGCTGTTGGAGG + Intergenic
1015858657 6:137652725-137652747 CTGGGCACCAAAGCTGTTGTAGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016488367 6:144568414-144568436 AAGGGAAGGAATGCTGTTACAGG - Intronic
1016822929 6:148363055-148363077 CTGGGCAGATATGCTGATGTGGG + Intronic
1018206965 6:161445327-161445349 TTGGGCTGGAATGCAGTTGCTGG + Intronic
1018834659 6:167473877-167473899 CTGGGCAGGAGTGGAGTTGTGGG + Intergenic
1018838274 6:167501204-167501226 CAGGGCAGGAGGGCTGTGGCCGG - Intergenic
1018918891 6:168157057-168157079 CTGGGCACTGATGCTGTTGGAGG - Intergenic
1019319871 7:410759-410781 CCCTGCAGGAATGCTGCTGCGGG - Intergenic
1019738997 7:2663569-2663591 CTGGGCAGGTTGGCTGTGGCGGG - Exonic
1020129087 7:5549354-5549376 CTTGGCAGGAATGGTGTCCCGGG + Intronic
1020288730 7:6706476-6706498 CGGGGCGGGATTGCTGTCGCGGG + Exonic
1021613610 7:22480795-22480817 CTGTGTAGGCATGCTGTAGCTGG - Intronic
1023555303 7:41416029-41416051 CTGGGCAGGAATTCTGATGAAGG + Intergenic
1023939599 7:44761198-44761220 CTGGGCTGGACTGCTGAGGCAGG + Intronic
1024777032 7:52799566-52799588 TTAGGCAGGACTGCTCTTGCTGG - Intergenic
1027033113 7:74906368-74906390 CTGGGCTGGAGTGCAGTGGCAGG + Intergenic
1029136384 7:98375348-98375370 CTGGGCTGGAGTGCAGTGGCCGG - Intronic
1030278885 7:107749997-107750019 CTGGGCTGGAATGCAGTGGTGGG + Intronic
1031134314 7:117869515-117869537 GTGGACAGGAAGGCTGTGGCTGG - Intronic
1032559292 7:132872013-132872035 CTAGGAAGGAATGCTGTGGCAGG + Intronic
1034915311 7:155033921-155033943 CCTGGCAGGAATGCAGTAGCAGG - Intergenic
1036429154 8:8673922-8673944 CTGGGAAGGAATTCAGTTGGTGG + Intergenic
1039768770 8:40661375-40661397 CTGGGCATGATGGCTGATGCCGG - Intronic
1041481012 8:58319868-58319890 CTGGGCAAGGATTCTGTTCCAGG + Intergenic
1041756007 8:61313749-61313771 CTCAACAGGAATGCTGTTGTTGG - Intronic
1042314921 8:67415776-67415798 CTAAGCAGAAATGGTGTTGCTGG - Intergenic
1043375286 8:79642036-79642058 CTGGGCAGGAAAGATCTTGGAGG - Intronic
1043736966 8:83760733-83760755 CTGGGCAAGGCTGCTGTTGAGGG - Intergenic
1045073724 8:98539795-98539817 CCAGGCTGGAGTGCTGTTGCGGG + Intronic
1047411537 8:124628412-124628434 CTGGGCAAGCATCCTGCTGCCGG - Intronic
1047493782 8:125395347-125395369 CTGGGCAGGGATGTTGCTGCTGG + Intergenic
1047760885 8:127953286-127953308 CTGTGCAGGAATGCTTTTACTGG + Intergenic
1048553216 8:135453311-135453333 CTGGGTAGCATTGCTGTTCCGGG + Intergenic
1051483214 9:17580742-17580764 CTGCCCAGGAATTCTGTGGCAGG + Intronic
1051605301 9:18912331-18912353 CTGATGAGGTATGCTGTTGCAGG - Intergenic
1052056462 9:23913072-23913094 CCAGGCAGGAATGCAGTGGCTGG - Intergenic
1055556328 9:77477301-77477323 CCAGGCTGGAATGCAGTTGCAGG - Intronic
1056881770 9:90400802-90400824 CTGGGCTGGAGTGCAGTGGCTGG - Intergenic
1057788573 9:98107267-98107289 ATGCCCAGGAATGCTATTGCTGG - Intronic
1058040389 9:100295747-100295769 CTGAGCAGGAAAGGTGCTGCTGG + Intronic
1058424413 9:104864139-104864161 CTGGGCAGTAATTCTGTGCCAGG - Intronic
1059656590 9:116363046-116363068 CGGGGAAGAAATGCTATTGCAGG + Intronic
1059657426 9:116369243-116369265 CTGTGCAGGAATTCTGGTTCAGG - Intronic
1061012611 9:127964338-127964360 CTGGGCAGTAATGCTGGATCAGG - Intronic
1062595899 9:137299080-137299102 CAGAGCAGGATGGCTGTTGCTGG - Intergenic
1185463258 X:341932-341954 CTGGAAAGGAATGCGGTTGATGG + Intronic
1185709480 X:2291755-2291777 CCGGGCTGGAGTGCTGTGGCAGG + Intronic
1185856869 X:3544145-3544167 CTGGACATGAATCCTGCTGCTGG - Intergenic
1187315620 X:18191499-18191521 CTGCCCAAGAGTGCTGTTGCTGG - Intronic
1188762860 X:34053995-34054017 CTGGGCACCAAAGCTGTTGCAGG - Intergenic
1190477219 X:50840128-50840150 CTGGGCAGGAAGGCTGGGGAGGG - Intergenic
1190480242 X:50870217-50870239 CTTGGCAGGAAGGCTGGTGAGGG + Intergenic
1192261854 X:69510406-69510428 CTTGGCAGGAAAGCTGTGGCAGG - Intronic
1193026612 X:76851914-76851936 CTGTGCAGAAATGTTGGTGCAGG - Intergenic
1194706150 X:97178125-97178147 CTTGGGGGGAATGCTGATGCAGG + Intronic
1195535977 X:106009622-106009644 CTGGGCATGATGGCTGATGCCGG - Intergenic
1199601436 X:149543676-149543698 TGGGGCAGGAACGCTGTAGCTGG + Intronic
1200807357 Y:7446309-7446331 CTGGACATGAATCCTGCTGCTGG + Intergenic