ID: 1067693538

View in Genome Browser
Species Human (GRCh38)
Location 10:48519708-48519730
Sequence GGCAGTCGAGCCTGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 619}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067693538_1067693550 18 Left 1067693538 10:48519708-48519730 CCACCTGCCCAGGCTCGACTGCC 0: 1
1: 0
2: 3
3: 43
4: 619
Right 1067693550 10:48519749-48519771 CATCTTGAGAGGAAGTGGTGTGG No data
1067693538_1067693549 13 Left 1067693538 10:48519708-48519730 CCACCTGCCCAGGCTCGACTGCC 0: 1
1: 0
2: 3
3: 43
4: 619
Right 1067693549 10:48519744-48519766 GATGGCATCTTGAGAGGAAGTGG No data
1067693538_1067693548 7 Left 1067693538 10:48519708-48519730 CCACCTGCCCAGGCTCGACTGCC 0: 1
1: 0
2: 3
3: 43
4: 619
Right 1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG No data
1067693538_1067693543 -5 Left 1067693538 10:48519708-48519730 CCACCTGCCCAGGCTCGACTGCC 0: 1
1: 0
2: 3
3: 43
4: 619
Right 1067693543 10:48519726-48519748 CTGCCCTCAGGCCCATTTGATGG No data
1067693538_1067693551 23 Left 1067693538 10:48519708-48519730 CCACCTGCCCAGGCTCGACTGCC 0: 1
1: 0
2: 3
3: 43
4: 619
Right 1067693551 10:48519754-48519776 TGAGAGGAAGTGGTGTGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067693538 Original CRISPR GGCAGTCGAGCCTGGGCAGG TGG (reversed) Intronic
900391079 1:2434211-2434233 GGGGGCCGCGCCTGGGCAGGGGG + Intronic
900401673 1:2475321-2475343 GCCAGTAGAGCCTGGGCAGTGGG + Intronic
900520901 1:3105086-3105108 GTCAGGAGTGCCTGGGCAGGAGG + Intronic
900654243 1:3747192-3747214 GGCCGGCCCGCCTGGGCAGGCGG + Intergenic
900667280 1:3824120-3824142 GGCACTCCAGCCTGGGCAACAGG - Intronic
901234819 1:7662065-7662087 GGCAGTCCGCTCTGGGCAGGAGG + Intronic
901512727 1:9725517-9725539 TGCACTCCAGCCTGGGCAGCAGG + Intronic
901583000 1:10261304-10261326 TGCATTCCAGCCTGGGCAAGAGG - Intronic
901642433 1:10699412-10699434 GTCAGTAGAGCCTGGGGATGTGG + Intronic
902618355 1:17636090-17636112 TGCAGTTGAGCCAGGGCAGAAGG - Intronic
902954514 1:19915960-19915982 TGCAGTCCAACCTGGGCAAGAGG + Intergenic
903877561 1:26485964-26485986 GGCACTCTAGCCTGGGCAACAGG - Intergenic
904038250 1:27570190-27570212 GGCAGGGCAGCTTGGGCAGGGGG - Intronic
905012735 1:34758314-34758336 TGCCGTCGAGCTGGGGCAGGTGG - Exonic
905063808 1:35162588-35162610 TGCAGTCCAGCCTGGGCAACTGG - Intergenic
905394522 1:37658317-37658339 GGGAGCTGAGCCTGGGCAGTTGG - Intergenic
905482496 1:38271267-38271289 GGCTCTGGAGCCAGGGCAGGAGG - Intergenic
905872788 1:41414791-41414813 GGCAGTCGGGGCTGGGTGGGGGG - Intergenic
905957372 1:42009963-42009985 GGCACTCCAGCCTGGGCAACAGG - Intronic
905995528 1:42378050-42378072 GACAGTTGAGCCTGGACTGGAGG + Intergenic
906049168 1:42856549-42856571 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
906378389 1:45315699-45315721 GGCACTCCAGCCTGGGCAATAGG + Intergenic
906405427 1:45538306-45538328 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
907046677 1:51303815-51303837 GGCAGTGTGGCCTGGCCAGGAGG - Intronic
907188371 1:52629414-52629436 GCCAGTGCAGCCAGGGCAGGAGG + Intergenic
907191357 1:52651578-52651600 TGCACTCCAGCCTGGGCAAGAGG - Intronic
907301618 1:53490366-53490388 GGAAGTGGAGCCTGGGCTGGTGG - Intergenic
909581582 1:77241551-77241573 TGCACTCCAGCCTGGGCAAGAGG + Intergenic
909924696 1:81425900-81425922 TGCAGTCCAGCCTGGGCAACAGG - Intronic
912640607 1:111341973-111341995 GGGAGTCGAGCATGAGCATGGGG + Intergenic
912655775 1:111485323-111485345 GGCACTCAAGCCTGGGCAACAGG + Intronic
912809805 1:112785432-112785454 TGCACTCCAGCCTGGGCAAGAGG + Intergenic
912812616 1:112805441-112805463 TGCAGGCTGGCCTGGGCAGGTGG + Intergenic
914761793 1:150605097-150605119 TGCACTCCAGCCTGGGCAGGGGG - Intronic
916405059 1:164489947-164489969 GGCAGCCTAGCCTGGGATGGTGG + Intergenic
916775571 1:167960332-167960354 TGCACTCCAGCCTGGGCAAGAGG - Intronic
919857899 1:201718251-201718273 GGAGGTGGAGCTTGGGCAGGTGG + Intronic
920260039 1:204683186-204683208 TGCAGAGGAGCCTGGGCTGGTGG - Intronic
922394447 1:225182160-225182182 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1064179225 10:13100298-13100320 GGCAGGTGAGCCAGGGCAGGGGG + Exonic
1064209201 10:13348511-13348533 CGCGGTCGAGCCCGGCCAGGTGG - Intergenic
1064677281 10:17774078-17774100 TGCAGTCCAGCCTGGGCAATAGG - Intronic
1064954818 10:20896034-20896056 GGAAGTCAGTCCTGGGCAGGAGG - Intronic
1065183337 10:23148614-23148636 GGCACTCCAGCCTGGGCAACAGG - Intergenic
1065645188 10:27826643-27826665 AGGAGATGAGCCTGGGCAGGAGG - Intronic
1065830285 10:29608713-29608735 GGCAGCTGAGCGTGGGCATGTGG + Intronic
1067047076 10:42990863-42990885 GGCAGTCAAGTCAGGGCTGGTGG - Intergenic
1067065567 10:43102273-43102295 GGCAGTCGGGAATGGGGAGGAGG - Intronic
1067693538 10:48519708-48519730 GGCAGTCGAGCCTGGGCAGGTGG - Intronic
1069919472 10:71807773-71807795 GGGACTGGAGCCTGGGCACGAGG + Intronic
1070043968 10:72812180-72812202 TGCACTCTAGCCTGGGCAGTAGG - Intronic
1070851149 10:79562520-79562542 GGCAATGGGGCCTGAGCAGGGGG - Intergenic
1070856047 10:79608718-79608740 GGCAGTGGAGCCTAAGCAGGGGG + Intergenic
1070948716 10:80413799-80413821 AGCAGACGGGCCTGGGCAGGCGG - Intronic
1071032677 10:81203952-81203974 TGCACTCCAGCCTGGGCAAGAGG + Intergenic
1071346942 10:84702042-84702064 GGCAGCAGACCCTGTGCAGGTGG - Intergenic
1071928753 10:90441205-90441227 GGGAGTGGAGCTTGGCCAGGTGG - Intergenic
1072692692 10:97582338-97582360 GGCAGTCCGGACAGGGCAGGTGG + Exonic
1072983009 10:100115328-100115350 GGCAGCCGGGCCGGGGCTGGGGG - Intergenic
1073104173 10:101022806-101022828 TGCACTCTAGCCTGGGCAGCAGG - Intronic
1074322668 10:112417465-112417487 TGCACTCCAGCCTGGGCAGTAGG + Intronic
1074357916 10:112802201-112802223 GGCACTCCAGCCTGGGCAACAGG + Intronic
1075559950 10:123460929-123460951 GGCAGGCGAGCTAGGCCAGGAGG - Intergenic
1076730546 10:132436844-132436866 GTCAGGGGAGCCAGGGCAGGCGG - Intergenic
1077226864 11:1442400-1442422 GGCAGTGGGCTCTGGGCAGGGGG + Intronic
1077228905 11:1450075-1450097 GGCAGGCAGGCATGGGCAGGAGG - Intronic
1077327845 11:1971397-1971419 GGCAGCCGAGCCAGGGCCCGGGG - Intronic
1077330302 11:1981238-1981260 GGGAGCAGAGCCTGGGCCGGTGG - Intronic
1077331923 11:1987607-1987629 GGGGGTCTAGGCTGGGCAGGTGG + Intergenic
1077358805 11:2130758-2130780 GGCAGTGGGGGCTGGGCGGGGGG - Intronic
1077409585 11:2397259-2397281 GGCTCTCGAACCGGGGCAGGAGG - Exonic
1077443914 11:2581426-2581448 GGCAGCCCAGCCTGTGCATGTGG + Intronic
1077461786 11:2714411-2714433 GGCAGTGGAGTCAGGGCAGCTGG + Intronic
1077481456 11:2816718-2816740 GGGAGTCCAGCCAGGGCAGTGGG - Intronic
1078316092 11:10294259-10294281 GGCAGCCGAGCCAGCGCGGGTGG - Intergenic
1079427859 11:20360691-20360713 GGCAGTCCAGGGTGGGCAGGCGG + Intergenic
1081124018 11:39300499-39300521 TGCACTCCAGCCTGGGCAGTGGG + Intergenic
1083255620 11:61493782-61493804 GGCAGTTTGGCCAGGGCAGGGGG + Intergenic
1083543935 11:63535397-63535419 TGCAGTCTAGCCTGGGCAACTGG - Intergenic
1083615658 11:64024830-64024852 GGCAGTCGGGCCTGCCCAGCTGG - Intronic
1083661025 11:64251820-64251842 GGCAGGCGAGGCTGGGGTGGGGG - Intronic
1083779708 11:64911446-64911468 TTCAGTTGAGCCTGGGCAGAAGG - Intronic
1084153018 11:67299922-67299944 GGGGGCCGAGCCTGGGCGGGAGG + Intronic
1084190246 11:67495398-67495420 GGCAGTCCAGCCTGGGGGTGGGG - Intronic
1084581615 11:70027682-70027704 GACAGTCAGGTCTGGGCAGGAGG + Intergenic
1084686106 11:70696455-70696477 AGAAGTGGACCCTGGGCAGGTGG - Intronic
1084703746 11:70804074-70804096 GGAAGTCGGGTCTGGGCAGCAGG - Intronic
1085356059 11:75838371-75838393 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1085432704 11:76467941-76467963 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1087567869 11:99885244-99885266 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1087855933 11:103091896-103091918 GGCAGGGGAGCCGGGGAAGGGGG + Exonic
1088288209 11:108208550-108208572 TGCACTCGAGCCTGGGCAACAGG + Intronic
1088573746 11:111249614-111249636 GACAGTCGAGTTTGGGAAGGTGG - Intergenic
1088782257 11:113147456-113147478 GGCAGTTGAGCCTGTGCTTGGGG - Intronic
1088812649 11:113401919-113401941 GGCACTCCAGTCTGGGCATGGGG + Intergenic
1089643185 11:119860953-119860975 GGCAGCCTAGCCAGAGCAGGGGG + Intergenic
1090019744 11:123117460-123117482 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1090212417 11:124931241-124931263 TGCAGTCCAGCCTGGGCAATAGG - Intronic
1090905313 11:131069316-131069338 AGCAGGCAGGCCTGGGCAGGGGG - Intergenic
1202810825 11_KI270721v1_random:26577-26599 GGCAGCCGAGCCAGGGCCCGGGG - Intergenic
1202813281 11_KI270721v1_random:36417-36439 GGGAGCAGAGCCTGGGCCGGTGG - Intergenic
1202814904 11_KI270721v1_random:42783-42805 GGGGGTCTAGGCTGGGCAGGTGG + Intergenic
1091645413 12:2268971-2268993 GACATCCGACCCTGGGCAGGGGG - Intronic
1092393238 12:8100446-8100468 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1092658679 12:10715508-10715530 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1094096431 12:26710184-26710206 GGCACTCCAGCCTGGGCAACAGG + Intronic
1095450461 12:42325862-42325884 GGCAGCCGAGTCTGGGGAGGGGG + Intronic
1095976440 12:47943501-47943523 GGCCGTCCATCCTGGGCAAGGGG + Intergenic
1096405223 12:51339213-51339235 TGCAGCTGAGCCTGGACAGGTGG - Intronic
1096429572 12:51531867-51531889 GGCAGTCCAGCCTGGGGAAGGGG - Intergenic
1096454969 12:51777293-51777315 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1096676915 12:53231113-53231135 GGCAGGGGAGCCTGAGTAGGAGG - Intronic
1096683352 12:53271623-53271645 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1096701806 12:53388942-53388964 AGCACTCCAGCCTGGGCAGTAGG + Intronic
1096735429 12:53649569-53649591 TGCACTCCAGCCTGGGCAGTAGG + Intronic
1096758993 12:53824340-53824362 GGCAATCCAGCCTGAGGAGGGGG - Intergenic
1097994281 12:65870691-65870713 TGCACTCTAGCCTGGGCAGGGGG + Intronic
1101683009 12:106987307-106987329 GGCAGCCCAGCCTGTGCTGGCGG + Intergenic
1101930869 12:109012891-109012913 TGCACTCGAGCCTGGGCAACTGG + Intronic
1102766197 12:115435446-115435468 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1103567669 12:121824945-121824967 TGCACTCGAGCCTGGGCAACAGG + Intronic
1104669176 12:130668661-130668683 AGCAGCCGAGACTGGGCAGGTGG - Intronic
1104684929 12:130778587-130778609 GGAAGACCAGCCTGGGCAGCTGG - Intergenic
1105391707 13:19985664-19985686 GGCACTCCAGCCTGGGCAACAGG + Intronic
1105490615 13:20884339-20884361 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1105744810 13:23367628-23367650 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1105926920 13:25017367-25017389 GGGAGTGGAGCCTGGGCCTGAGG - Intergenic
1106491542 13:30228786-30228808 GGCACTCCAGCCTGGGCAACAGG - Intronic
1107464208 13:40634604-40634626 TGCATTCCAGCCTGGGCAGCAGG + Intronic
1107626720 13:42294436-42294458 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1108533031 13:51345218-51345240 GCCTGTGGACCCTGGGCAGGAGG - Intronic
1108633878 13:52313641-52313663 TGCATTCCAGCCTGGGCAGCAGG - Intergenic
1108634299 13:52317340-52317362 TGCATTCCAGCCTGGGCAGCAGG - Intergenic
1110623346 13:77624138-77624160 TGCACTCCAGCCTGGGCAAGAGG - Intronic
1111730656 13:92072607-92072629 TGCACTCCAGCCTGGGCAAGAGG - Intronic
1111973566 13:94941901-94941923 TGCAGTCCAGCCTGGGCAACAGG + Intergenic
1112177800 13:97045131-97045153 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1113234979 13:108262539-108262561 GGCAGTCTAGCCTCAGGAGGTGG + Intronic
1113910795 13:113840301-113840323 GGCAGTGCAGCCTGGGCCTGGGG - Intronic
1114242685 14:20883098-20883120 TGCACTCTAGCCTGGGCAAGAGG - Intergenic
1114249616 14:20947030-20947052 TGCACTCTAGCCTGGGCAAGAGG - Intergenic
1114330496 14:21632372-21632394 GGCACTCCAGCCTGGGCGGCAGG + Intergenic
1115275095 14:31599955-31599977 TGCATTCCAGCCTGGGCAGCAGG - Intronic
1115551293 14:34507549-34507571 TGCACTCCAGCCTGGGCTGGAGG - Intergenic
1115643196 14:35348701-35348723 GGCACTCCAGCCTGGGCATCAGG - Intergenic
1115768168 14:36645362-36645384 TGCGGTAGAGCCTGGGGAGGGGG - Intergenic
1116267655 14:42714916-42714938 GTCACTTGAGCCTGGGGAGGGGG - Intergenic
1118852390 14:69593916-69593938 GGCAGTTGAGTCTGGGCAAAGGG + Intergenic
1119394741 14:74318081-74318103 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1119845450 14:77826175-77826197 GGGAGTTGTGCCTGGGAAGGGGG + Intronic
1119893432 14:78200185-78200207 GGCAGGCGATCTTGGGAAGGAGG + Intergenic
1121307599 14:92916819-92916841 GGGGTTGGAGCCTGGGCAGGGGG + Intergenic
1121402830 14:93695853-93695875 TGCAGTCCAGCCTGGGCAACAGG + Intronic
1121638622 14:95470613-95470635 TGCACTCAAGCCTGGGCAGCAGG + Intronic
1121660572 14:95632293-95632315 GGCCGCCGACCCAGGGCAGGTGG - Intergenic
1121832918 14:97067332-97067354 GGAAGACGTCCCTGGGCAGGGGG - Intergenic
1122165658 14:99821689-99821711 TGCACTCCAGCCTGGGCAGAAGG + Intronic
1122203044 14:100134038-100134060 AGCAGTCGTGCCTGTGCAGAGGG - Intronic
1122476628 14:102014492-102014514 TGCATTCGAGCCTGGGCAACAGG + Intronic
1123063528 14:105605153-105605175 GGCAGTGGAGCCTGGGTAGGGGG + Intergenic
1123087588 14:105723939-105723961 GGCAGTGGAGCCTGGGTGGGGGG + Intergenic
1123707283 15:22959525-22959547 GGCAGTCCCGCCTGCTCAGGAGG + Intronic
1124118457 15:26868074-26868096 GGCCGGCGCGCCAGGGCAGGTGG - Intronic
1124235876 15:27989055-27989077 ACCAGTGGAGCCTGGGCAGCAGG - Intronic
1124905240 15:33862246-33862268 TGCACTCGAGCCTGGGCAACGGG - Intronic
1126012598 15:44317339-44317361 TGCACTCTAGCCTGGGCAGTAGG + Intronic
1126734144 15:51714600-51714622 TGCAGTGCAGCCTGGGCAGTGGG - Intronic
1127225084 15:56919256-56919278 GGAGGCCGAGCCTGGGGAGGAGG + Intronic
1127649701 15:60995108-60995130 GGCAGTGGAGACTGGGAGGGTGG + Intronic
1128060707 15:64733918-64733940 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
1128069358 15:64784698-64784720 TGCACTCCAGCCTGGGCAGCTGG - Intergenic
1128636525 15:69305864-69305886 GGCAGACGATCTTTGGCAGGGGG + Intronic
1129393577 15:75232677-75232699 GACAGTCCAGCCTGGGCCAGGGG - Intergenic
1129409404 15:75340638-75340660 GGCAGTGAAACCTGGGCAAGAGG - Intronic
1129487321 15:75886825-75886847 TGCAGTCCAGCCTGGGCAATAGG + Intronic
1129974834 15:79813317-79813339 GGCGGTGGGGCCCGGGCAGGAGG + Intergenic
1130042424 15:80415986-80416008 AGCAGTGGAGAGTGGGCAGGGGG - Intronic
1130306385 15:82714694-82714716 GGCAGTTGAGTCTGGGGAAGGGG - Intergenic
1130860493 15:87881929-87881951 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1131271470 15:90950035-90950057 GGGAGTCAAGCCTGGGGAGAGGG + Intronic
1131380829 15:91962591-91962613 GGAAGTGGAGCCGGGGAAGGAGG + Intronic
1131530143 15:93183963-93183985 GGGATTCGAACCTGGGCAGAAGG - Intergenic
1132017853 15:98334859-98334881 GGCTGGGGAGCCTGGGCAGGAGG + Intergenic
1132352192 15:101146832-101146854 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1132659330 16:1054455-1054477 GGCAGGCTGGCCGGGGCAGGGGG + Intergenic
1132727629 16:1345690-1345712 GGCAGGGGAGGCTGGGGAGGTGG - Intronic
1132873890 16:2127460-2127482 GCCAGTGCAGCCTGGGCGGGTGG - Intronic
1133266773 16:4589540-4589562 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1133368995 16:5233932-5233954 TGCAGTCCAGCCTGGGCACAGGG + Intergenic
1133613428 16:7454195-7454217 GGCACTCCAGCCTGGGCAGGAGG + Intronic
1133936840 16:10276281-10276303 TGCACTCGAGCCTGGGCAATAGG - Intergenic
1134170866 16:11968439-11968461 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1134194192 16:12146299-12146321 TGCACTCTAGCCTGGGCAAGAGG - Intronic
1134348544 16:13414678-13414700 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1134373614 16:13649310-13649332 TGCAGTCCAGCCTGGGCAACAGG - Intergenic
1134398126 16:13884369-13884391 TGCATTTCAGCCTGGGCAGGAGG - Intergenic
1134408342 16:13982201-13982223 TGCACTCCAGCCTGGGCAAGAGG + Intergenic
1134552976 16:15146634-15146656 GCCAGTGCAGCCTGGGCGGGTGG - Intergenic
1134861167 16:17561750-17561772 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1135407940 16:22211493-22211515 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1135546677 16:23371511-23371533 GGCAGTTGGCCCTGGACAGGTGG - Intronic
1135563537 16:23494585-23494607 GGCAGTGTGCCCTGGGCAGGAGG - Intronic
1136071226 16:27788474-27788496 GGCAGTGGAGCCAGGCCAGGAGG - Exonic
1136275162 16:29175542-29175564 GGCAGTAGGGCCTGTGCAGATGG + Intergenic
1136331986 16:29586152-29586174 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1136446680 16:30326215-30326237 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1136465069 16:30437149-30437171 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1136547727 16:30965118-30965140 GGCAGGGGAGGCTGGGCGGGGGG - Exonic
1137421052 16:48334424-48334446 GGCCGTAGGGCCTGGGCAGGAGG + Intronic
1138083765 16:54115596-54115618 GGCAGGAGAGCCTTGGGAGGGGG + Exonic
1139413201 16:66782899-66782921 GGCACTCCAGCCTGGGCAACAGG - Intronic
1139766134 16:69231551-69231573 TGCATTCCAGCCTGGGCAGCAGG + Intronic
1139851985 16:69956209-69956231 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1139880957 16:70179111-70179133 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1139906399 16:70369213-70369235 TGCACTCCAGCCTGGGCAAGAGG - Intronic
1140371549 16:74416406-74416428 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1140389571 16:74573625-74573647 GGAGGTCGAGCCTGGGCAACAGG - Intronic
1140469647 16:75206901-75206923 GGCAGCTGAGCCTGGGAGGGAGG + Intronic
1140858566 16:78999432-78999454 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1140902755 16:79384719-79384741 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
1141711326 16:85700831-85700853 TGCACTCTAGCCTGGGCAGCAGG + Intronic
1141784714 16:86191440-86191462 TTTTGTCGAGCCTGGGCAGGAGG - Intergenic
1142079523 16:88141610-88141632 GGCAGTAGGGCCTGTGCAGATGG + Intergenic
1142283701 16:89162206-89162228 GGCAGAGGAGGGTGGGCAGGTGG - Intergenic
1143070819 17:4291322-4291344 TGCAGTCTAGCCTGGGCAACGGG + Intronic
1143189760 17:5032943-5032965 GGCCCCTGAGCCTGGGCAGGTGG - Exonic
1143192965 17:5053953-5053975 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1143778126 17:9212750-9212772 GGCTGTCGGGCTTGGGAAGGTGG - Intronic
1144244930 17:13353401-13353423 GGCAGTGCTGGCTGGGCAGGTGG - Intergenic
1144577482 17:16438098-16438120 TGCAGTCCAGCCTGGGCAACAGG + Intergenic
1144800605 17:17923652-17923674 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1144952971 17:19004046-19004068 GGCAGCAGTGCCCGGGCAGGCGG - Exonic
1144997066 17:19277363-19277385 GGCACTCCAGCCTGGGCAAAAGG + Intronic
1145930509 17:28682007-28682029 GGCATTCTAGCCTGAGCAAGGGG + Intronic
1146253945 17:31378050-31378072 GGCAGCTGAGCCAGGGGAGGTGG - Intronic
1146950144 17:36900011-36900033 GGCAGAAGACCCAGGGCAGGTGG + Intergenic
1147164599 17:38586603-38586625 GGCAGTATTCCCTGGGCAGGGGG - Intronic
1147202116 17:38809598-38809620 GGCAGTGAAGCCTGGGCTGCTGG - Intronic
1147209525 17:38864119-38864141 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1147295841 17:39481754-39481776 CGCAGTCCAGCCTGGGCAACAGG - Intronic
1147754963 17:42761767-42761789 GGCAGTGGAGCCTGCGAGGGGGG - Intronic
1147891503 17:43720677-43720699 GGCAGCCTGGCCTGGGCAGCAGG + Intergenic
1148327359 17:46790946-46790968 AGGAGTCAGGCCTGGGCAGGGGG - Intronic
1148570458 17:48664166-48664188 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1148823841 17:50377789-50377811 TGCATTCTAGCCTGGGCAGCAGG - Intronic
1149318229 17:55458735-55458757 GGCAGTCTGGCCAGGGCAGTGGG + Intergenic
1149332220 17:55595998-55596020 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1149581734 17:57755454-57755476 GGCAGGCATGCCTGGGCTGGTGG - Intergenic
1149606266 17:57927225-57927247 GGCAGGCGGGCCTGGGCAGCAGG + Intronic
1149695164 17:58610848-58610870 TGCATTCCAGCCTGGGCAAGAGG + Intronic
1149824726 17:59817236-59817258 GGCACTCCAGCCTGGGCAACTGG + Intronic
1150221244 17:63497024-63497046 GGCTGCCCAGCCTGGGGAGGGGG - Intronic
1150376868 17:64688709-64688731 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
1150475285 17:65470392-65470414 GGCACTCCAGCCTGGGCAACAGG - Intergenic
1151227179 17:72656043-72656065 AGCTGACGATCCTGGGCAGGTGG + Intronic
1151662470 17:75525915-75525937 GGCTGTCGGGCCAGGGCGGGAGG + Intronic
1151758886 17:76089684-76089706 GGCAGCCCAGGGTGGGCAGGTGG + Intronic
1151971320 17:77458964-77458986 GGAAGTGGAGCCTGGAAAGGTGG + Intronic
1153307105 18:3641499-3641521 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1153742597 18:8144560-8144582 GGCACTCCAGCCTGGGCAACAGG + Intronic
1154210933 18:12377642-12377664 GGCTTCCGAGCCTGGGCAGCCGG + Intergenic
1155187806 18:23402766-23402788 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1155799384 18:30081776-30081798 GGTGGTGGAGCCTGGCCAGGTGG + Intergenic
1155908810 18:31485352-31485374 TGCACTCCAGCCTGGGCAAGAGG + Intergenic
1157271749 18:46281676-46281698 GGGAGTCTAGACTGGGCATGTGG + Intergenic
1157297145 18:46454075-46454097 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1157801981 18:50628078-50628100 GGCAGTAGGGGCTGGGGAGGGGG + Intronic
1158155919 18:54425505-54425527 AGCACTCCAGCCTGGGCAAGAGG - Intergenic
1159827558 18:73233052-73233074 GCCAGTCGAGCTTGTGCATGAGG + Intronic
1160207864 18:76851299-76851321 TGCATTCCAGCCTGGGCAAGAGG - Intronic
1160536843 18:79599041-79599063 GGCAGGCAGGCCTGGGAAGGTGG + Intergenic
1160918396 19:1508323-1508345 GGCGGTGGAGCCTAGGGAGGGGG + Intronic
1161039696 19:2103639-2103661 GACAGGAGAGGCTGGGCAGGTGG + Intronic
1161153779 19:2721995-2722017 GGCAGTCAGGCCTAGGGAGGTGG + Intronic
1161244489 19:3241809-3241831 TGCACTCCAGCCTGGGCAAGAGG - Intronic
1161342210 19:3749373-3749395 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1163486504 19:17590419-17590441 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
1163734904 19:18973840-18973862 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1163800764 19:19363782-19363804 TGCAGTCCAGCCTGGGCAACAGG + Intergenic
1164251576 19:23482009-23482031 GACAGATCAGCCTGGGCAGGTGG - Intergenic
1164320323 19:24138483-24138505 GACAGGTCAGCCTGGGCAGGTGG + Intergenic
1165772178 19:38386215-38386237 GGGCTTCGAGCCTGGGAAGGTGG + Exonic
1165990672 19:39810981-39811003 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1166068252 19:40372834-40372856 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1166076959 19:40419370-40419392 GGCAGTTGTGCCAGGGCTGGCGG + Intergenic
1167399498 19:49255507-49255529 GGCAGTGGTCCCAGGGCAGGGGG + Intergenic
1167446757 19:49542563-49542585 CTCAGCCGAGCCTGGGGAGGAGG + Exonic
1168323688 19:55526043-55526065 GGGAGTGGAGACTGGGCAGGGGG - Intergenic
1168636978 19:58003913-58003935 TGCACTCCAGCCTGGGCAGCAGG + Intronic
925134146 2:1514826-1514848 GTGAAACGAGCCTGGGCAGGGGG - Intronic
925171145 2:1750856-1750878 GGCAGGGGAGTCTGGGCAGGGGG + Intergenic
925191912 2:1892015-1892037 GGTACGCGCGCCTGGGCAGGTGG - Exonic
925688395 2:6495528-6495550 GGCAGTCTGGCCTGGGAAGAAGG + Intergenic
926005421 2:9369875-9369897 TGCACTCCAGCCTGGGCAAGAGG - Intronic
926311209 2:11677527-11677549 GACACTGGAGCCTGGGCAGGCGG - Intergenic
926349290 2:11980905-11980927 GGCAGGACAGACTGGGCAGGGGG - Intergenic
926896393 2:17693962-17693984 TGCACTCCAGCCTGGGCAAGAGG + Intronic
927124319 2:19999423-19999445 GGCTGTAGAGGCTGGGGAGGTGG - Intronic
927163993 2:20298801-20298823 TGCACTCCAGCCTGGGCAAGAGG + Intronic
927469206 2:23359735-23359757 AGAAGTCAAGCCTGGTCAGGCGG - Intergenic
927543634 2:23933684-23933706 TGCACTCCAGCCTGGGCAGCAGG + Intronic
927719680 2:25374596-25374618 TGCAGACGCGCCTGTGCAGGAGG + Intergenic
927809425 2:26173301-26173323 GGCAGGCGAGCGTGGGCAGGCGG - Exonic
927853123 2:26512178-26512200 GGCAGGAGAGCCAGGCCAGGTGG + Intronic
927937502 2:27083916-27083938 GACAGGCGGGCCTGGGCAGGCGG + Exonic
928910743 2:36418388-36418410 GGAAGCTGAGCCTGGGGAGGTGG - Intronic
929780260 2:44952695-44952717 CCCAGTCGGGCCTGGCCAGGCGG - Intergenic
931376039 2:61709086-61709108 TGCATTCCAGCCTGGGCTGGAGG + Intergenic
931388015 2:61814677-61814699 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
931447819 2:62341618-62341640 TGCAATCTAGCCTGGGCAAGGGG - Intergenic
931645175 2:64415730-64415752 GGCACTCCAGCTTGGGCAAGTGG + Intergenic
931911107 2:66901332-66901354 GTCAGTGGAGCCTGCTCAGGCGG - Intergenic
932137747 2:69245414-69245436 GGAGGTGGAGCCTGGGGAGGAGG - Exonic
932237938 2:70136044-70136066 GGGGGTGGAGGCTGGGCAGGGGG - Intergenic
932602760 2:73140542-73140564 TGCACTCCAGCCTGGGCAAGAGG - Intronic
932687839 2:73888181-73888203 TGCATTCCAGCCTGGGCAGCAGG + Intergenic
933291356 2:80441957-80441979 GGCAGTCCTCCATGGGCAGGTGG + Intronic
933447356 2:82398762-82398784 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
934559751 2:95307003-95307025 AGCAGCCGAGCCTGGGAAGCTGG - Intronic
934763905 2:96869954-96869976 GGCGGGCGAGCGCGGGCAGGCGG - Exonic
934958750 2:98648462-98648484 TGCAGTCCAGCCTGGGCTAGAGG + Intronic
935756468 2:106279817-106279839 GGCACTCGAGACTGGAAAGGGGG - Intergenic
936366897 2:111865916-111865938 ATCATTCGAGGCTGGGCAGGTGG + Intronic
936649947 2:114414286-114414308 TGCAGTCCAGCCTGGGCAACAGG - Intergenic
937288457 2:120767666-120767688 GGCAGTGGGGGCTGGGCAGAGGG - Intronic
937856643 2:126676827-126676849 GGCACTTGAGCCAGGGCAGGTGG + Intronic
938081956 2:128374875-128374897 GGCAGTCCAGCCAGGGGCGGGGG - Intergenic
938300631 2:130208937-130208959 GGCAGTGGTGCTTGGGTAGGCGG + Intergenic
938456094 2:131465534-131465556 GGCAGTGGTGCTTGGGTAGGCGG - Intronic
938899215 2:135785736-135785758 TGCACTCCAGCCTGGGCAAGCGG - Intergenic
940969244 2:159876971-159876993 TGCACTCCAGCCTGGGCAAGAGG + Intronic
941185610 2:162318481-162318503 TGCACTCGCACCTGGGCAGGTGG + Exonic
941234791 2:162957757-162957779 TGCATTTGTGCCTGGGCAGGAGG + Intergenic
941844886 2:170122510-170122532 GGCAGAAGAGCCAGGGGAGGAGG - Intergenic
942058880 2:172209619-172209641 GGTAGTCAGGTCTGGGCAGGAGG + Intergenic
944102633 2:196045029-196045051 TGCACTCCAGCCTGGGCAAGAGG + Intronic
944773533 2:202938286-202938308 GGCACTCTAGCCTGGGCAACAGG - Intronic
945063309 2:205926916-205926938 AGCACTGGAGCCTGGGAAGGAGG - Intergenic
945128596 2:206541128-206541150 TGCACTCCAGCCTGGGCAGCAGG + Intronic
946258697 2:218467193-218467215 TGCACTCCAGCCTGGGCAGGGGG - Intronic
946421508 2:219567674-219567696 GACAGGCGAGGCAGGGCAGGAGG - Intronic
947226543 2:227845925-227845947 TGCACTCGAGCCTGGGCAACAGG + Intergenic
947513999 2:230785364-230785386 GGCAGGGGCGCGTGGGCAGGGGG + Intronic
947734491 2:232447655-232447677 GGCAGTGGGGCCCGGGCAGAAGG - Intergenic
948361420 2:237423157-237423179 TGCACTCCAGCCTGGGCAGCAGG + Intronic
948385912 2:237580701-237580723 TGCACTCCAGCCTGGGCAGCAGG + Intronic
948968804 2:241407260-241407282 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1168826008 20:814559-814581 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1169435468 20:5583510-5583532 TGCACTCCAGCCTGGGCGGGTGG + Intronic
1169708760 20:8537528-8537550 GTCAGGTGACCCTGGGCAGGTGG - Intronic
1169831243 20:9827773-9827795 GGCAGTGGAGACAGGGAAGGGGG + Intronic
1169947050 20:11000175-11000197 GCTAATCGAGCCAGGGCAGGAGG - Intergenic
1170163692 20:13341913-13341935 CGCAGGCTAGCCTGGGCTGGTGG + Intergenic
1170180558 20:13525284-13525306 AGCTGTGGAGCCTGGGCAAGGGG - Intronic
1170808244 20:19653211-19653233 GGCAGAGGAGCCAGGGCTGGAGG - Intronic
1171450948 20:25236003-25236025 GGCAGGCTGGCCTGGGCAGGAGG - Intergenic
1172566496 20:35934679-35934701 GGCAGGGCAGGCTGGGCAGGTGG + Intronic
1172624581 20:36339946-36339968 GGCAGTGGAGGCTGGGTTGGGGG + Intronic
1173522740 20:43711616-43711638 GGTGGGAGAGCCTGGGCAGGGGG + Intronic
1173669735 20:44790402-44790424 GGTAGAGGAGCCTGGGGAGGAGG - Intronic
1173922627 20:46757705-46757727 GGCTGTCGGCCCTAGGCAGGAGG + Intergenic
1173999715 20:47365608-47365630 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
1174238801 20:49116368-49116390 TGCACTCCAGCCTGGGCAGCTGG - Intronic
1174761060 20:53207710-53207732 TGCACTCCAGCCTGGGCAGGAGG - Intronic
1175623673 20:60472780-60472802 GTCAGGCCAGGCTGGGCAGGGGG - Intergenic
1176063645 20:63183046-63183068 GGCATTCCAGCCTGGTCCGGGGG + Intergenic
1177754907 21:25334760-25334782 GGCAGTGGAGACTGGGCTGGAGG + Intergenic
1178628543 21:34239264-34239286 GGCATTCCAGCCTGGGCAACAGG + Intergenic
1180098428 21:45572620-45572642 GGCACTCCAGCCTGGGCAACAGG - Intergenic
1180188509 21:46151855-46151877 GGCGGTCGGGCCTGGGAAGGAGG - Intronic
1180612768 22:17108583-17108605 GGCAGGCGCTCCTGGGCCGGGGG + Exonic
1180754778 22:18153458-18153480 GGCACTCCAGCCTGGGCAACAGG - Intronic
1180764235 22:18234348-18234370 AGCAGGGGGGCCTGGGCAGGAGG + Intergenic
1180771406 22:18390193-18390215 CGCAGGGGGGCCTGGGCAGGAGG - Intergenic
1180802788 22:18639808-18639830 CGCAGGGGGGCCTGGGCAGGAGG - Intergenic
1180834452 22:18922861-18922883 GGCTGTGGAGCAAGGGCAGGCGG - Exonic
1180842501 22:18965883-18965905 GGCAGTCAAACCTGGGTTGGGGG - Intergenic
1180943407 22:19675519-19675541 TGCACTCCAGCCTGGGCAAGGGG - Intergenic
1181001936 22:19991888-19991910 GGCTGGCGGGACTGGGCAGGAGG - Intronic
1181218930 22:21355453-21355475 CGCAGGGGGGCCTGGGCAGGAGG + Intergenic
1181280178 22:21714131-21714153 TGCAGGCGTGCCTGCGCAGGTGG - Intronic
1181440239 22:22931972-22931994 GGGAGCCCAGCATGGGCAGGGGG - Intergenic
1181592549 22:23894277-23894299 GGGGGTCGAGCCGAGGCAGGCGG + Exonic
1181986582 22:26804051-26804073 TGCAGTAGGGCCTGGGTAGGAGG + Intergenic
1182421558 22:30250999-30251021 GGGAGGCCAGCCTGGGCAGCCGG - Intergenic
1182443072 22:30375424-30375446 GGCACACCAGCTTGGGCAGGTGG - Intronic
1182446774 22:30394283-30394305 TGCAGTCCAGCCTGGGCAACAGG - Intronic
1183105267 22:35610859-35610881 AGGAGCAGAGCCTGGGCAGGTGG - Intronic
1183229525 22:36572664-36572686 TGCACTCTAGCCTGGGCAGTGGG + Intronic
1183352958 22:37343993-37344015 GGCAGGGGGGCATGGGCAGGTGG - Intergenic
1183352963 22:37344007-37344029 GGCAGGCGGGCATAGGCAGGGGG - Intergenic
1183352969 22:37344021-37344043 GGCAGGTGGGCGTGGGCAGGCGG - Intergenic
1183352974 22:37344035-37344057 GGCAGGTGGGCATGGGCAGGTGG - Intergenic
1183353002 22:37344102-37344124 GGCAGGCGGGCATAGGCAGGGGG - Intergenic
1183353008 22:37344116-37344138 GGCAGGTGGGCATGGGCAGGCGG - Intergenic
1183353013 22:37344130-37344152 GGCAGGTGGGCATGGGCAGGTGG - Intergenic
1183353035 22:37344183-37344205 GGCAGGTGTGCATGGGCAGGTGG - Intergenic
1183353049 22:37344224-37344246 GGCAGGTGGGCATGGGCAGGTGG - Intergenic
1183353610 22:37347012-37347034 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1183704788 22:39469808-39469830 GGATGGCGAGCCTGGGCGGGAGG + Intronic
1183838893 22:40481070-40481092 TGCAGTCTAGCCTGGGCAACAGG + Intronic
1184412960 22:44336491-44336513 TGCAGAGGAGGCTGGGCAGGTGG - Intergenic
1184530370 22:45051606-45051628 GGCCATGGAGCCTGGGAAGGAGG - Intergenic
1185053799 22:48567567-48567589 GGCTGGCCAGCGTGGGCAGGTGG + Intronic
1185239754 22:49736160-49736182 GCCAGCAGGGCCTGGGCAGGGGG - Intergenic
1185299438 22:50071936-50071958 AGCAGGGGAGCCTGGGCAGCAGG + Intronic
1203233246 22_KI270731v1_random:131184-131206 AGCAGGGGGGCCTGGGCAGGAGG - Intergenic
1203284541 22_KI270734v1_random:148160-148182 GGCTGTGGAGCAAGGGCAGGCGG - Intergenic
950020059 3:9780629-9780651 GGCATGCCAGCCTGGGCTGGTGG - Intronic
950032601 3:9862545-9862567 GGCAGTCGCGTCCAGGCAGGCGG + Intergenic
950369848 3:12520031-12520053 GGCACTCCAGCCTGGGCAACAGG - Intronic
950421341 3:12901368-12901390 GGCAGGTGGGCCTGGGGAGGGGG + Intronic
950606522 3:14086161-14086183 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
950819567 3:15742664-15742686 GGCAGGCTGGCATGGGCAGGGGG - Intronic
951723976 3:25734674-25734696 TGCACTCCAGCCTGGGCAAGAGG + Intronic
951973854 3:28480899-28480921 TGCACTCCAGCCTGGGCAAGAGG - Intronic
952394391 3:32908368-32908390 TGCAGTCCAGCCTGGGCAATAGG - Intergenic
952963006 3:38604499-38604521 GGCACTGGAGCCGGGGCTGGGGG - Intronic
953029614 3:39170213-39170235 TGCAGTCCAGCCTGGGCAACAGG - Intergenic
953180260 3:40588418-40588440 GGGAGTCGAGGCAGGGCGGGGGG + Intergenic
953345822 3:42174520-42174542 TGCACTCCAGCCTGGGCAGCAGG - Intronic
953949069 3:47174533-47174555 TGCAGTCCAGCCTGGGCAACAGG - Intergenic
953986592 3:47447967-47447989 TGCACTCCAGCCTGGGCAAGAGG + Intronic
954057672 3:48041145-48041167 TGCACTCCAGCCTGGGCAGCAGG - Intronic
954108010 3:48419606-48419628 GGTAGTCGAGGCTGGACGGGAGG + Exonic
955168688 3:56541439-56541461 GGCATTCCAGCCTGGGCAACAGG - Intergenic
955286269 3:57644663-57644685 GGCAGACCAGCCTGGGCAACAGG + Intronic
956412110 3:68990386-68990408 GGCACTCTAGCCTGGGCAACAGG - Intronic
956417263 3:69045709-69045731 GGCAGACTAGCCTGGGCAACAGG + Intronic
956506888 3:69950257-69950279 TGCACTCCAGCCTGGGCAAGAGG + Intronic
957048589 3:75395152-75395174 GGGAGTGGAGCCTGGGCCTGAGG - Intergenic
959591917 3:108091015-108091037 GGCCGTGCAGCCTGGGCAGTGGG - Intronic
960901805 3:122561419-122561441 TGCACTCCAGCCTGGGCAAGAGG + Intronic
960944697 3:122958141-122958163 GGCTGTCAGGCCTGGGCTGGGGG - Intronic
962043851 3:131734853-131734875 GGCACTCCAGCCTGGGCAACAGG + Intronic
962711461 3:138090102-138090124 TGCACTCGAGCCTGGGCAACAGG + Intronic
962795230 3:138844142-138844164 GGCACTCCAGCCTGGGCAACAGG + Intergenic
964838865 3:160971797-160971819 GGCACTCCAGCCTGGGCAACAGG - Intronic
965538224 3:169847219-169847241 TGCACTCCAGCCTGGGCAGCAGG - Intronic
965788711 3:172364467-172364489 GGCAGTGGAGGCAGGGCACGGGG - Intronic
966191729 3:177277693-177277715 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
966453032 3:180084105-180084127 TGCAGTCTAGCCTGGGCAACAGG + Intergenic
966665508 3:182466701-182466723 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
967506355 3:190257268-190257290 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
967738698 3:192981926-192981948 TGCAGTCCAGCCTGGGCAACAGG - Intergenic
968255478 3:197266012-197266034 GGCACTCCAGCCTGGGCAACGGG + Intronic
968286166 3:197510101-197510123 GGCAGAAGAGCCCGGGCAGCCGG - Exonic
968466786 4:755947-755969 TGCACTCCAGCCTGGGCAAGAGG - Intronic
968849621 4:3070011-3070033 TGCACACCAGCCTGGGCAGGGGG - Intergenic
968925222 4:3543483-3543505 GGCAGCCGAGGAGGGGCAGGGGG - Intergenic
969180332 4:5435831-5435853 CCCTGTCTAGCCTGGGCAGGAGG + Intronic
969205751 4:5643857-5643879 GGCACTCCAGCCTGGGCAATAGG + Intronic
969428576 4:7139846-7139868 AGCACTGGAGCCTGGGAAGGAGG - Intergenic
969689700 4:8697718-8697740 GGCACTCTAGCCTGGGCAACAGG + Intergenic
969694099 4:8725193-8725215 GGCAGCCGGGACTGGGCATGTGG + Intergenic
969977852 4:11122567-11122589 TGCATTCCAGCCTGGGCAGCAGG + Intergenic
971440132 4:26676681-26676703 TGCACTCCAGCCTGGGCAGCAGG + Intronic
972417276 4:38853648-38853670 TGCACTCCAGCCTGGGCAGTGGG - Intronic
972594413 4:40517168-40517190 TGCACTCCAGCCTGGGCAAGAGG - Intronic
973802544 4:54493404-54493426 AGCCGCCGAGGCTGGGCAGGTGG + Intergenic
977452735 4:97219719-97219741 TGCAGTCCAGCCTGGGCAACAGG + Intronic
977971380 4:103217904-103217926 GGCAGGAGACCCTGGTCAGGAGG - Intergenic
978492750 4:109326285-109326307 TGCACTCCAGCCTGGGCTGGAGG + Intergenic
979264186 4:118682617-118682639 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
980025480 4:127760924-127760946 AGCACTCCAGCCTGGGCGGGGGG + Intronic
980894834 4:138852207-138852229 GGGAGTCGAGTCTCGGCAGGAGG - Intergenic
982223624 4:153145707-153145729 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
982749966 4:159149294-159149316 TGCACTCCAGCCTGGGCAAGAGG - Intronic
983267440 4:165522431-165522453 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
983977877 4:173957160-173957182 TGCACTCCAGCCTGGGCAAGAGG + Intergenic
984667501 4:182444834-182444856 TGCATTCCAGCCTGGGCAGCTGG - Intronic
985269558 4:188181176-188181198 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
985693396 5:1326004-1326026 GGCAGGCGTACCTGGTCAGGTGG + Intronic
986761825 5:10886976-10886998 GGCAGGAGAGCTTGTGCAGGGGG + Intergenic
988169644 5:27637261-27637283 GGCACTCCAGCCTGGGCGGCAGG - Intergenic
988263874 5:28926780-28926802 GGGAGTGGAGCCTGGGCCTGAGG - Intergenic
988514372 5:31891944-31891966 TGCAGTCCAGCCTGGGCAACAGG - Intronic
988800099 5:34688648-34688670 GGGAGGAGAGCCTGGGGAGGAGG + Intronic
989546630 5:42681898-42681920 TGCAGTCCAGCCTGGGCAAAAGG + Intronic
990139776 5:52689981-52690003 GGCACTCCAGCCTGGGCAACAGG - Intergenic
990225443 5:53647246-53647268 TGCACTCCAGCCTGGGCAAGGGG - Intronic
990257890 5:53990195-53990217 TGCACTCCAGCCTGGGCAGCAGG + Intronic
990582870 5:57182117-57182139 TGCACTCCAGCCTGGGCAAGAGG - Intronic
993234370 5:85284726-85284748 TGCATTCTAGCCTGGGCAAGAGG - Intergenic
993877555 5:93326153-93326175 AGCAGACGAGCCAGGGCCGGTGG - Intergenic
994169434 5:96642575-96642597 TGCACTCCAGCCTGGGCAGCAGG - Intronic
994194527 5:96907592-96907614 GGCAGACTAGCCGGGCCAGGTGG + Intronic
994374487 5:99003909-99003931 GGCACTCCAGCCTGGGCAACAGG - Intergenic
995715463 5:115078087-115078109 TGCAGTCCAGCCTGGGCAACAGG + Intergenic
997557134 5:134809975-134809997 TGCACTCCAGCCTGGGCAGCAGG + Intronic
997954505 5:138268247-138268269 TGCACTCCAGCCTGGGCAGCAGG + Intronic
998968988 5:147570778-147570800 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
999244068 5:150144137-150144159 GGCAGCCGAGCCTGTGCTGGAGG - Intronic
999328290 5:150656795-150656817 AGCAGCCGAGCCGGGGCGGGCGG - Intronic
1000288315 5:159846859-159846881 AGCAGTAGAGGCGGGGCAGGGGG - Intergenic
1000811983 5:165874500-165874522 TGCAGTCCAGCCTGGGCAACAGG + Intergenic
1001342736 5:170862263-170862285 GGCGGCCGAGCCTGGGTTGGAGG + Intronic
1001520989 5:172392747-172392769 GGCACTCCAGCCTGGGCAACAGG + Intronic
1002430888 5:179203209-179203231 GGCCGTCGAGCCCTGGGAGGAGG - Intronic
1003227250 6:4217593-4217615 TGCAGTCCAGCCTGGGCAACAGG - Intergenic
1003679422 6:8237277-8237299 GGCACTCCAGCCTGGGCAACAGG - Intergenic
1004253345 6:14040839-14040861 AGCAGTTGAGCCTGTGCAGGTGG + Intergenic
1004490722 6:16112278-16112300 TGCAGTCCAGCCTGGGCAACAGG + Intergenic
1005052291 6:21695839-21695861 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1005281759 6:24282276-24282298 TGCACTCTAGCCTGGGCAGTAGG - Intronic
1006503566 6:34473582-34473604 GGCAGCCGAGGCAGGGCTGGAGG + Intronic
1006903586 6:37518347-37518369 AGGAGTGGAGCCTGGGCAGTGGG - Intergenic
1006906403 6:37536403-37536425 GGCAGTGGGGCGGGGGCAGGGGG + Intergenic
1006934876 6:37710349-37710371 GGCAGCCAAGGCTGGGCAGGAGG - Intergenic
1006995620 6:38257237-38257259 TGCAGTCCAGTCTGGGCAGCAGG - Intronic
1007721439 6:43887640-43887662 GGCTGTGCAGCCTGGGCTGGGGG + Intergenic
1008383089 6:50855795-50855817 GGCAAGAGAGCCTGTGCAGGGGG - Intergenic
1008914250 6:56769779-56769801 TGCACTCCAGCCTGGGCAAGTGG + Intronic
1010024659 6:71201301-71201323 GGCAGGAGGGACTGGGCAGGTGG + Intergenic
1011756385 6:90502282-90502304 TGCACTCCAGCCTGGGCAAGAGG + Intergenic
1013069395 6:106715023-106715045 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1013126709 6:107191288-107191310 GGCAGTGGAGACTGAGCAGTAGG + Intronic
1014089330 6:117385475-117385497 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1014867716 6:126552323-126552345 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1015826026 6:137312692-137312714 TGCACTCCAGCCTGGGCAAGAGG + Intergenic
1015941144 6:138453388-138453410 TGCACTCTAGCCTGGGCAAGAGG - Intronic
1016500660 6:144717669-144717691 TGCAGTCCAGCCTGGGCAACTGG - Intronic
1016501518 6:144725929-144725951 AGGAGGCAAGCCTGGGCAGGTGG - Intronic
1017132999 6:151123966-151123988 GGTACTCCAGCCTGGGCAAGAGG - Intergenic
1017534219 6:155329213-155329235 GGAAGTGGAGCCTGGGCAAGAGG - Intergenic
1017747727 6:157461719-157461741 GGCAGCAGAGGGTGGGCAGGTGG + Intronic
1017867999 6:158461373-158461395 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1018453950 6:163935610-163935632 GGCAGCCAAGGCTGGGCAGAAGG - Intergenic
1018466588 6:164052031-164052053 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1018666419 6:166142243-166142265 TGCATTCCAGCCTGGGCAGGAGG + Intergenic
1018739312 6:166715103-166715125 GGCAGTGGAGGGTGGGCAGGTGG + Intronic
1019123794 6:169825714-169825736 GGCAGGCGACCCTGGTCAGCAGG - Intergenic
1019221586 6:170477696-170477718 GCCAGTGGGGCCTGGGCAGGAGG + Intergenic
1019473575 7:1233464-1233486 GGGGGTCGGGCCTGGGCCGGTGG + Intronic
1019549914 7:1596922-1596944 CGCAATCGTGCCTGGGCGGGTGG + Intergenic
1020783711 7:12548153-12548175 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1021942273 7:25689533-25689555 GGCCATGGGGCCTGGGCAGGAGG + Intergenic
1022250774 7:28605854-28605876 ATCAGTTGAGCCTGGGAAGGGGG + Intronic
1022346919 7:29525889-29525911 GGCAGTGGAGATGGGGCAGGTGG - Intergenic
1022729576 7:33009726-33009748 TGCACTCTAGCCTGGGCAGAGGG + Intergenic
1023393139 7:39729663-39729685 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
1023405516 7:39829853-39829875 TGCACTCTAGCCTGGGCGGGAGG - Intergenic
1023827126 7:44017119-44017141 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1023835107 7:44063318-44063340 TGCACTCCAGCCTGGGCAAGAGG - Intronic
1024019122 7:45349182-45349204 GGCAGAAGAGCCTGGGCTGGAGG + Intergenic
1024479415 7:49848462-49848484 CACAGCCGACCCTGGGCAGGTGG - Intronic
1024926511 7:54620629-54620651 TGCAGTCCAGCCTGGGCAACAGG - Intergenic
1025770065 7:64496012-64496034 TGCAGTCCAGCCAGGGCAGTAGG - Intergenic
1025995596 7:66525401-66525423 GGCAGTTGTCCCAGGGCAGGTGG + Intergenic
1025996850 7:66533013-66533035 TGCATTCCAGCCTGGGCAAGAGG - Intergenic
1026046612 7:66909953-66909975 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1026576994 7:71580712-71580734 GGGAGTCCAGGCTGAGCAGGTGG + Intronic
1026597589 7:71746891-71746913 GGCACTCCAGCCTGGGCAACAGG + Intergenic
1026898050 7:74021933-74021955 GGCAGGCGAGGCTGGGCCAGGGG - Intergenic
1026932265 7:74230003-74230025 TGCACTCCAGCCTGGGCAAGAGG + Intergenic
1028272554 7:88810625-88810647 TGCACTCTAGCCTGGGCAGCAGG + Intronic
1029285899 7:99465943-99465965 GGAAGGCGCGCCTGGGCAGGCGG + Intronic
1029738280 7:102476865-102476887 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1029755410 7:102570521-102570543 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1029773359 7:102669601-102669623 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1030286702 7:107834252-107834274 GGCAGTCCAGCCTAGGCAACAGG - Intergenic
1030812811 7:113996160-113996182 TGCATTCCAGCCTGGGCAGTAGG - Intronic
1031446778 7:121864627-121864649 GGCATTCCAGCCTGGGCAACAGG + Intergenic
1032217832 7:129971036-129971058 GGCAGCCAAGGCTGGGGAGGTGG + Intergenic
1032431689 7:131867394-131867416 GGGACTGGAGCCTGGGCTGGAGG + Intergenic
1032883778 7:136116347-136116369 GGCAGTGGAGGCTGTGCTGGGGG + Intergenic
1033190053 7:139269840-139269862 GGCACTCCAGCCTGGGCAACGGG - Intronic
1033208605 7:139443595-139443617 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1033256445 7:139805794-139805816 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1034052510 7:147998145-147998167 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1034441736 7:151089075-151089097 GCCAGGAGAGGCTGGGCAGGGGG - Intronic
1034983933 7:155496144-155496166 GGCAGTGGTGTGTGGGCAGGGGG + Intronic
1035602132 8:902921-902943 GGCGGTGGAACGTGGGCAGGTGG + Intergenic
1035705411 8:1670937-1670959 GGCAGCCTTGCCAGGGCAGGAGG + Intronic
1035825970 8:2644514-2644536 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1035942647 8:3920067-3920089 TGCAGTCTAGCCAGGGCAGAAGG - Intronic
1036204277 8:6793972-6793994 GGAAGTGGGGCCTGGGGAGGTGG - Intergenic
1036483917 8:9162732-9162754 GGCAGTCTTTCCTGAGCAGGAGG - Intronic
1036550725 8:9813171-9813193 TGCACTCGAGCCTGGGCAATAGG - Intergenic
1037624690 8:20596537-20596559 GGCAGCAGAGCCTGGCCTGGAGG - Intergenic
1038732810 8:30142389-30142411 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1039056814 8:33543460-33543482 GGCAGTGGGGGCGGGGCAGGGGG + Intergenic
1039157883 8:34582353-34582375 TGCACTCCAGCCTGGGCAGCTGG + Intergenic
1039335726 8:36587097-36587119 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
1040027995 8:42799318-42799340 TGCACTCCAGCCTGGGCAGTGGG - Intergenic
1040593664 8:48818476-48818498 CCCAGTGGAGCCTGGCCAGGGGG + Intergenic
1042146666 8:65736916-65736938 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1042594343 8:70429906-70429928 GGCACTCCAGCCTGGGCTGACGG - Intergenic
1043333639 8:79147322-79147344 GGCAAGGGAGTCTGGGCAGGTGG - Intergenic
1045594401 8:103635897-103635919 GGCTGGAGAGCTTGGGCAGGGGG + Intronic
1045702443 8:104882315-104882337 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1047020620 8:120771903-120771925 TGCACTCCAGCCTGGGCAAGGGG - Intronic
1047254024 8:123202066-123202088 GGCAGTGGGGGCGGGGCAGGAGG - Intronic
1047307013 8:123660887-123660909 TGCAGTCCAGCCTGGGCAATGGG - Intergenic
1047533401 8:125697684-125697706 GGCACTCCAGCCTGGGCAACAGG - Intergenic
1047996818 8:130344699-130344721 TGCATTCCAGCCTGGGCAGCAGG + Intronic
1048037796 8:130693677-130693699 GGCAGTAGAGGCTGGGCTGTGGG + Intergenic
1048108517 8:131440236-131440258 GGAAGTGCAGCCTGGGCAGAAGG + Intergenic
1049408648 8:142462765-142462787 AGCAGTTGAGCCTGTGCAGGAGG - Intronic
1049427081 8:142542453-142542475 GGCGGTGGGGGCTGGGCAGGGGG - Exonic
1049507344 8:143010090-143010112 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
1049704560 8:144035175-144035197 GGCAGGCGGGCCTGGGGAGGAGG - Intronic
1050035987 9:1436879-1436901 TGCACTCCAGCCTGGGCAGCCGG - Intergenic
1050380674 9:5024951-5024973 GGGAGTGGAGCCGGGGCTGGTGG + Intronic
1050658515 9:7856474-7856496 CGCACTCCAGCCTGGGCAAGAGG + Intronic
1050871989 9:10583485-10583507 GGCAGTCCAGCCTGGGCAACAGG - Intronic
1051898437 9:22012563-22012585 GGCCATGGGGCCTGGGCAGGAGG - Intronic
1052964021 9:34325307-34325329 TGCACTCCAGCCTGGGCAGTAGG + Intronic
1052999465 9:34569650-34569672 AGCAGTCGAGTCAGGGCAGTGGG + Intronic
1053249310 9:36561182-36561204 GGCACTCCATCCTGGGCAAGAGG - Intergenic
1053800112 9:41758665-41758687 GGCAGCCGAGGAGGGGCAGGGGG - Intergenic
1054077185 9:60547150-60547172 GGGAGTGGAGCCTGGGCCTGCGG + Intergenic
1054145078 9:61556170-61556192 GGCAGCCGAGGAGGGGCAGGCGG + Intergenic
1054188540 9:61970817-61970839 GGCAGCCGAGGAGGGGCAGGGGG - Intergenic
1054464776 9:65487127-65487149 GGCAGCCGAGGAGGGGCAGGGGG + Intergenic
1054649981 9:67617800-67617822 GGCAGCCGAGGAGGGGCAGGGGG + Intergenic
1054904534 9:70403112-70403134 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1055083977 9:72295407-72295429 GGCACTCCAGCCTGGGCAACAGG + Intergenic
1055409826 9:76017177-76017199 GGAAATGGAGCCTGGGGAGGGGG - Intronic
1057928472 9:99172852-99172874 GTCAGTGGAGCCTGGACAGATGG - Intergenic
1058571211 9:106346972-106346994 GGCACTCCAGCCTGGGCAACAGG + Intergenic
1058920631 9:109611308-109611330 GGAATTAGAGGCTGGGCAGGAGG - Intergenic
1059133620 9:111781685-111781707 GGCACTCCAGCCTGGGCACCTGG + Intronic
1059156738 9:111996062-111996084 GGCACTCCAGCCTGGGCAACAGG + Intergenic
1059326987 9:113509857-113509879 GGCAGTTGAGCCTGGTCAGTTGG + Intronic
1059484633 9:114617245-114617267 GGCACTCCAGCCAGGGGAGGAGG - Exonic
1059522578 9:114957363-114957385 GTCACTTGAGCCTGGGGAGGTGG + Intergenic
1060722321 9:125987300-125987322 GCCACCCCAGCCTGGGCAGGGGG - Intergenic
1060733693 9:126053019-126053041 AGCAGGGGAGCCCGGGCAGGTGG - Intergenic
1061016531 9:127983978-127984000 GGCAGACGAGCCTGTGCACATGG + Intergenic
1061104327 9:128517252-128517274 TGCACTCTAGCCTGGGCAGCAGG + Intronic
1061174156 9:128982392-128982414 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1061201409 9:129140543-129140565 GGTAGGCGAGGCTGGCCAGGAGG + Intronic
1061428936 9:130519019-130519041 GGCAGGGGTGCCTGGGAAGGAGG + Intergenic
1061450648 9:130665293-130665315 GGCAGCCGGGGCTGGGGAGGGGG + Intronic
1061520501 9:131114759-131114781 GGCAGTGGTGCCAGGGCAGAAGG - Intronic
1061939568 9:133876723-133876745 GGCAGGAAGGCCTGGGCAGGAGG + Intronic
1062340537 9:136092140-136092162 GGCAGTCGGGCCTTGGGTGGGGG - Intronic
1062460268 9:136659973-136659995 GGGGCTGGAGCCTGGGCAGGAGG + Intronic
1185602145 X:1347581-1347603 TGAAGTCTAGCCTGGGCAAGCGG + Intronic
1186520775 X:10204995-10205017 GGCAGAGGAGCCTGGGCTGGGGG + Intronic
1187532546 X:20109998-20110020 TGCACTCCAGCCTGGGCAAGAGG + Intronic
1187703673 X:21988627-21988649 TGCAGTCCAGCCTGGGCAAGAGG + Intronic
1188810588 X:34649759-34649781 TGCACTCCAGCCTGGGCAGCAGG - Intronic
1189133935 X:38529590-38529612 GGCAGTGGATACTGGGCAGCTGG + Intronic
1189180962 X:39004135-39004157 GGCTGTGGAGGCTGGGCTGGAGG + Intergenic
1190247276 X:48698951-48698973 GGCAGGAGAGCTTGGCCAGGCGG - Exonic
1190261755 X:48802037-48802059 AGCGGTCGGGTCTGGGCAGGGGG + Exonic
1190760803 X:53436553-53436575 TGCACTCCAGCCTGGGCAGCGGG - Intergenic
1190869873 X:54415795-54415817 GGCACTGGAGGCAGGGCAGGGGG - Intergenic
1190877450 X:54470155-54470177 GGCACACTAGCCAGGGCAGGGGG + Exonic
1192121284 X:68458621-68458643 TGCACTCCAGCCTGGGCAGCAGG - Intergenic
1192227803 X:69241397-69241419 GGCAGTAGGGCTGGGGCAGGGGG - Intergenic
1192620551 X:72675150-72675172 TGCACTCCAGCCTGGGCAGCAGG + Intronic
1195716750 X:107825942-107825964 GGAAGGTGAGCCTGGGAAGGTGG + Exonic
1196302622 X:114064265-114064287 TGCACTCCAGCCTGGGCAGCAGG + Intergenic
1197758994 X:130014802-130014824 GGAAGTGGAGCCCAGGCAGGAGG - Exonic
1198587092 X:138134360-138134382 TGCACTCCAGCCTGGGCAAGAGG - Intergenic
1199716524 X:150510884-150510906 GGCACTCCAGCCTGGACAAGTGG - Intronic
1200105718 X:153710964-153710986 GGCAGTCGAGCTTGGGTTGCTGG - Intronic
1200116911 X:153773483-153773505 GGCAGTCGGGTGTGGGCGGGCGG - Intronic
1202188636 Y:22217517-22217539 TGCAGTCCAGCCTGGGCAAGAGG - Intergenic
1202240115 Y:22758306-22758328 TGCAGTCCAGCCTGGGCGAGAGG + Intergenic
1202393101 Y:24392068-24392090 TGCAGTCCAGCCTGGGCGAGAGG + Intergenic
1202477684 Y:25278049-25278071 TGCAGTCCAGCCTGGGCGAGAGG - Intergenic
1202580284 Y:26373379-26373401 TGCACTCCAGCCTGGGCAAGAGG + Intergenic