ID: 1067693539

View in Genome Browser
Species Human (GRCh38)
Location 10:48519711-48519733
Sequence GAGGGCAGTCGAGCCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 289}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067693539_1067693549 10 Left 1067693539 10:48519711-48519733 CCTGCCCAGGCTCGACTGCCCTC 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1067693549 10:48519744-48519766 GATGGCATCTTGAGAGGAAGTGG No data
1067693539_1067693548 4 Left 1067693539 10:48519711-48519733 CCTGCCCAGGCTCGACTGCCCTC 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG No data
1067693539_1067693550 15 Left 1067693539 10:48519711-48519733 CCTGCCCAGGCTCGACTGCCCTC 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1067693550 10:48519749-48519771 CATCTTGAGAGGAAGTGGTGTGG No data
1067693539_1067693551 20 Left 1067693539 10:48519711-48519733 CCTGCCCAGGCTCGACTGCCCTC 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1067693551 10:48519754-48519776 TGAGAGGAAGTGGTGTGGTGCGG No data
1067693539_1067693543 -8 Left 1067693539 10:48519711-48519733 CCTGCCCAGGCTCGACTGCCCTC 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1067693543 10:48519726-48519748 CTGCCCTCAGGCCCATTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067693539 Original CRISPR GAGGGCAGTCGAGCCTGGGC AGG (reversed) Intronic
900151947 1:1182664-1182686 GAGGGCACTGGGGCCAGGGCTGG + Intronic
900175102 1:1288063-1288085 GGGGGCAGGTGAGGCTGGGCTGG + Intronic
900366160 1:2312787-2312809 GAGGGCAGGCGGCCCTGGCCTGG - Intergenic
900458052 1:2786863-2786885 CAGGGCATCCGAACCTGGGCAGG + Intronic
900626647 1:3611577-3611599 GGGGGCGGGCGAGCCAGGGCGGG - Intergenic
900667187 1:3823392-3823414 GAGGGCACGGGAGCCTGGGAAGG + Intronic
901372998 1:8816996-8817018 GAGGGGAGTCGGGCGAGGGCAGG - Intronic
902186824 1:14731681-14731703 GTGGGTAGCAGAGCCTGGGCTGG + Intronic
904565501 1:31425939-31425961 GTGGGGACTCGAGCCTGGGCAGG + Intronic
905643783 1:39610244-39610266 GAGGACAGCAGAGCCTGCGCGGG + Intergenic
905919591 1:41710635-41710657 TAGGGCAGGGAAGCCTGGGCGGG - Intronic
906508913 1:46400197-46400219 GGGGGCAGTGGTGCCTGGGTGGG + Intronic
907301619 1:53490369-53490391 GCAGGAAGTGGAGCCTGGGCTGG - Intergenic
912384830 1:109266033-109266055 GAGGGCTGGGGAGCCTGGGCAGG + Intronic
912869443 1:113290694-113290716 GAGGGCAGGTGAGACAGGGCAGG - Intergenic
915141925 1:153773289-153773311 GAGGGCAGTCCAGCCGGGGGTGG - Exonic
915344363 1:155190869-155190891 GGGGGCGGTGGAGCCGGGGCCGG + Intronic
915905957 1:159877323-159877345 GAGGGAAGTCGAGACTAAGCAGG + Intronic
915972770 1:160366199-160366221 GAGGGCAGGGCAGCCTAGGCAGG - Intergenic
917133045 1:171761789-171761811 GAGGGCAACCCAGACTGGGCTGG + Intergenic
917283916 1:173404921-173404943 GAGGGCAGTCAGGGCTGGGCAGG - Intergenic
920274189 1:204791876-204791898 TAGGGCTGCCGAGCCTGGGGTGG + Intergenic
920310103 1:205043711-205043733 GAGGGCAGTTTCTCCTGGGCCGG + Intronic
923160506 1:231310589-231310611 GTGGGCAGTGGGGCCTGGGGTGG + Intergenic
924415337 1:243850827-243850849 GGGGGCAGTCGCTCCCGGGCGGG + Intronic
1062931409 10:1354964-1354986 GAGGGCAGTGGAGCCCCTGCAGG + Intronic
1064198490 10:13264820-13264842 CAGTGCACTCCAGCCTGGGCTGG - Intergenic
1067232459 10:44421616-44421638 GAGGGGAGTAGAGCCTGGCCAGG - Intergenic
1067282064 10:44880393-44880415 GAGGGCTGGCGAGCCAGGCCTGG - Intergenic
1067524021 10:47027653-47027675 GAGGACACGGGAGCCTGGGCAGG - Intergenic
1067651602 10:48159434-48159456 GGAGGCAGCAGAGCCTGGGCTGG - Intronic
1067693539 10:48519711-48519733 GAGGGCAGTCGAGCCTGGGCAGG - Intronic
1068832099 10:61507293-61507315 TATGGCAGTGGAGCCTGGGTTGG + Intergenic
1069640769 10:69954129-69954151 GTGGGAAGTGGAGCCTGGGGGGG - Intronic
1069740114 10:70681975-70681997 GAGAGCAGGCCAGCCTGGACAGG - Intronic
1070856044 10:79608715-79608737 GGGGGCAGTGGAGCCTAAGCAGG + Intergenic
1070948717 10:80413802-80413824 GTGAGCAGACGGGCCTGGGCAGG - Intronic
1072620290 10:97075006-97075028 GAGCCCAGTCCAGCCTTGGCAGG - Intronic
1072983012 10:100115331-100115353 GACGGCAGCCGGGCCGGGGCTGG - Intergenic
1073292698 10:102421226-102421248 GAGGGGAGCCGAGCCGGGGCTGG + Intronic
1074483539 10:113851762-113851784 CAGGGCACTCCAGCCTGGGTGGG - Intronic
1075080386 10:119379590-119379612 GAGGGCGATAGAGCCTGGGAAGG - Intronic
1076636662 10:131885543-131885565 GAGGGCAGCCGCGCCCTGGCTGG + Intergenic
1076764707 10:132626836-132626858 GAGGGCAGTGGGGCATGAGCTGG - Intronic
1076781580 10:132727667-132727689 GAGGGCAGCAGGGCCAGGGCGGG - Intronic
1077306489 11:1870924-1870946 GAGGGCCGTCGAGCAAAGGCGGG + Intronic
1077358808 11:2130761-2130783 GGGGGCAGTGGGGGCTGGGCGGG - Intronic
1077664319 11:4094380-4094402 CACGGCTGTGGAGCCTGGGCTGG + Intergenic
1078107777 11:8369531-8369553 GGGGGCAGTGGGGCCTGGGGAGG + Intergenic
1078580493 11:12535962-12535984 GCTGGCAGTAGAGCCTAGGCTGG - Intergenic
1078900531 11:15638377-15638399 GGGAGGAGTTGAGCCTGGGCAGG - Intergenic
1078986753 11:16605339-16605361 GAGGGCAGTGGTGCCTGACCTGG - Intronic
1079104769 11:17563503-17563525 GAGAGCAGCCAAGCCAGGGCTGG - Intronic
1080475225 11:32583990-32584012 GACCGCTGCCGAGCCTGGGCCGG + Intronic
1082026823 11:47578726-47578748 GAGGGCGGGCGGGCCTGAGCGGG - Intronic
1083919782 11:65776185-65776207 GAGGAAAGACGGGCCTGGGCTGG - Exonic
1084153017 11:67299919-67299941 GCGGGGGGCCGAGCCTGGGCGGG + Intronic
1084625417 11:70302437-70302459 ATGGGCAGTGGAGTCTGGGCGGG + Intronic
1084726533 11:70945964-70945986 GAGGGAGGTAGAGCCTGGGAAGG - Intronic
1084726543 11:70946000-70946022 GAGGGAGGGCGAGCCTGGGAAGG - Intronic
1084726577 11:70946144-70946166 GAGGGAGGTTGAGCCTGGGAAGG - Intronic
1084726587 11:70946180-70946202 GAGGGAGGTTGAGCCTGGGAAGG - Intronic
1084726646 11:70946434-70946456 GAGGGAGGTTGAGCCTGGGAAGG - Intronic
1084726760 11:70946872-70946894 GAGGGAGGTTGAGCCTGGGAAGG - Intronic
1084726790 11:70946982-70947004 GAGGGAGGTTGAGCCTGGGAAGG - Intronic
1084726800 11:70947018-70947040 GAGGGAGGTTGAGCCTGGGAAGG - Intronic
1084945354 11:72635260-72635282 GAGGACAGAAGAGGCTGGGCTGG - Intronic
1085048239 11:73365669-73365691 GATGGCATCCGAGCCTGGGGTGG - Exonic
1088746284 11:112807670-112807692 CAGGGCAGTTGAGCCTGGGGAGG + Intergenic
1089468065 11:118698455-118698477 GAGCGCAGTCATGCCTGGGTGGG - Intergenic
1089646856 11:119886270-119886292 GAGGGCTGGGGAGCCTGGGGAGG - Intergenic
1090447420 11:126776062-126776084 GAGGGAAGTCAGGCCTGGCCTGG + Intronic
1095957231 12:47813707-47813729 GGGGGCTGTGGAGCTTGGGCGGG + Intronic
1097722434 12:63037555-63037577 GAGGGCAGAAGAACCTTGGCTGG + Intergenic
1099360206 12:81691209-81691231 GAGGTCACTCCTGCCTGGGCTGG - Intronic
1099431728 12:82594125-82594147 CCAGGCAGTCAAGCCTGGGCTGG + Intergenic
1102649882 12:114432851-114432873 GATGACTGTGGAGCCTGGGCAGG - Intergenic
1104079059 12:125414584-125414606 GAGGTCAGTGCAGGCTGGGCTGG - Intronic
1104448604 12:128852712-128852734 TAGGGTAGTCTAGCCTGGGAAGG + Intergenic
1108408629 13:50126960-50126982 GAGGGCAGGCAAGCCTGGAAAGG - Intronic
1110253881 13:73410166-73410188 GAGAGGAGCCCAGCCTGGGCAGG + Intergenic
1112314705 13:98350984-98351006 CAGGGGAGGCGAGGCTGGGCAGG - Intronic
1112314712 13:98351003-98351025 CAGGGGAGGCGAGGCTGGGCAGG - Intronic
1112314719 13:98351022-98351044 CAGGGGAGGCGAGGCTGGGCAGG - Intronic
1112314726 13:98351041-98351063 CAGGGGAGGCGAGGCTGGGCAGG - Intronic
1112314733 13:98351060-98351082 GTGGGGAGGCGAGGCTGGGCAGG - Intronic
1113120406 13:106918165-106918187 GTGGGGAGCCGAGGCTGGGCCGG + Intergenic
1114706838 14:24736270-24736292 GAGGATAGTGGAGCCTGGGAAGG - Intergenic
1115706204 14:36001000-36001022 GATGGCATTCATGCCTGGGCTGG + Intergenic
1115913903 14:38288004-38288026 GAGGGTACTAGAGGCTGGGCAGG + Intergenic
1117628673 14:57666841-57666863 TAGCTCAGTGGAGCCTGGGCTGG + Intronic
1119420205 14:74503728-74503750 GAGGGCCTTCCAGGCTGGGCTGG - Intronic
1121645269 14:95514212-95514234 CAGGGGACTCCAGCCTGGGCGGG - Intergenic
1123063525 14:105605150-105605172 CCGGGCAGTGGAGCCTGGGTAGG + Intergenic
1123087585 14:105723936-105723958 TCGGGCAGTGGAGCCTGGGTGGG + Intergenic
1123224071 14:106883654-106883676 GAGGGGAGTGGTGGCTGGGCGGG - Intergenic
1126098543 15:45106087-45106109 GAGGGCAGCCCAGGCTGGGGAGG + Intronic
1126434809 15:48625490-48625512 GAAGGGTGTCAAGCCTGGGCTGG - Intronic
1128950216 15:71871590-71871612 GAGGGCACTTGAGCCTGGCGAGG + Intronic
1129235455 15:74221267-74221289 GGGGGCAGTGGAGCAGGGGCAGG + Intergenic
1131151428 15:90049703-90049725 GAGGGCAGTGGGGCCTGGGAAGG - Intronic
1131276727 15:90988443-90988465 GAGGGCAGTGGAGCCTTTGAAGG - Intronic
1131380828 15:91962588-91962610 GAGGGAAGTGGAGCCGGGGAAGG + Intronic
1132083004 15:98883674-98883696 GAGGACAGCCTAGCCGGGGCAGG - Intronic
1132730048 16:1356677-1356699 GAGGGCAGCGGGGCCTGGCCTGG - Intronic
1133417791 16:5619815-5619837 GAAGGCAGTCAGACCTGGGCAGG + Intergenic
1133613427 16:7454192-7454214 CACGGCACTCCAGCCTGGGCAGG + Intronic
1135563538 16:23494588-23494610 GAGGGCAGTGTGCCCTGGGCAGG - Intronic
1136071227 16:27788477-27788499 GAGGGCAGTGGAGCCAGGCCAGG - Exonic
1136547730 16:30965121-30965143 GCGGGCAGGGGAGGCTGGGCGGG - Exonic
1136656313 16:31711391-31711413 GAGGGCAGACAGGCCAGGGCTGG - Intergenic
1137421051 16:48334421-48334443 CAGGGCCGTAGGGCCTGGGCAGG + Intronic
1137566824 16:49538511-49538533 GATGGCTGTGGAGCCTGGGGAGG - Intronic
1137582363 16:49641013-49641035 GAAGCCAGTCCAGCCTGGCCTGG - Intronic
1137726379 16:50659526-50659548 GGGGGCAGTGGCGCCTGGGCGGG + Intergenic
1137758567 16:50921895-50921917 GAGGGCAGGAGAGCCAGGACTGG - Intergenic
1138179307 16:54931338-54931360 GAAGGCAGTCGAGCCAGCGTAGG - Exonic
1138507050 16:57483670-57483692 GAGGGCAGCTGAGGCTAGGCAGG + Intronic
1138678802 16:58670641-58670663 GAGGGCAGTGGGGTCTGGGGTGG - Intronic
1139365793 16:66432774-66432796 GAGGGCAAAAGACCCTGGGCGGG - Intronic
1139474920 16:67198380-67198402 GGTGGCAGCCGAGCCTGGGCTGG - Exonic
1139521030 16:67482891-67482913 GATGGCAGTGGAGCATGGGAAGG + Intronic
1141244093 16:82290366-82290388 GAGGGCTGAGGAGCCTGGTCAGG + Intergenic
1141698929 16:85633619-85633641 CAGGGCAGTCCAGGCTGGGCAGG - Intronic
1142215522 16:88827886-88827908 GAGGGCTGTCGACACTGGGTGGG - Intronic
1142472724 17:172260-172282 GAGGACCCTCGAGCCTGGGGAGG - Intronic
1146214932 17:30971378-30971400 GAGGGAACTGGAGCCCGGGCAGG - Exonic
1146535633 17:33648141-33648163 GAGTCCAGTGGAGCCTGGGGAGG + Intronic
1146939922 17:36837270-36837292 AAGGGGAGTTGAGCCTGTGCAGG - Intergenic
1147673964 17:42192523-42192545 GAGGGCACTGGAGGCTGGGACGG - Exonic
1147967409 17:44200411-44200433 AAGGGCGGGGGAGCCTGGGCCGG - Intergenic
1148214379 17:45826475-45826497 CTGAGCAGTCGGGCCTGGGCCGG - Intronic
1148282850 17:46362257-46362279 GAGGGCAGTCTAGCCTCAGGCGG - Intergenic
1148305067 17:46580182-46580204 GAGGGCAGTCTAGCCTCAGGCGG - Intergenic
1148655442 17:49279816-49279838 GAAGCCAGTCAAGCATGGGCCGG - Intergenic
1148669758 17:49401981-49402003 GAAGGCAGTGCACCCTGGGCAGG - Intronic
1148878553 17:50707674-50707696 CGGGGCAGGCGGGCCTGGGCGGG - Exonic
1151228212 17:72662224-72662246 CATGGCAGTCCAGCCTGGACTGG + Intronic
1151758885 17:76089681-76089703 GAGGGCAGCCCAGGGTGGGCAGG + Intronic
1151763652 17:76121557-76121579 GAGGTGAGGCGAGCCCGGGCCGG + Intronic
1151885044 17:76918481-76918503 GAGGTCAGTCCATCCTGGGCAGG + Intronic
1152111320 17:78359240-78359262 GAAGGCAGGGGAGCCGGGGCGGG - Intronic
1152314440 17:79572143-79572165 TAGGGCAGTGGGGACTGGGCTGG + Intergenic
1152428021 17:80229190-80229212 GAGAACAGACCAGCCTGGGCAGG - Intronic
1152782114 17:82231196-82231218 GCGGGTGGTCGAGGCTGGGCGGG - Intronic
1152846172 17:82601087-82601109 AAGGGCACAGGAGCCTGGGCTGG - Intronic
1154356821 18:13627848-13627870 GAGGGCAGACGGTCCTGGGCAGG + Intronic
1155566253 18:27138001-27138023 GAGGGGAGTGGAGGCTGGGCAGG - Intronic
1157410657 18:47460270-47460292 GAGTGCAGTGGGGCTTGGGCTGG + Intergenic
1157580657 18:48772038-48772060 GAGAGCAGTGGCCCCTGGGCAGG + Intronic
1159881621 18:73863778-73863800 GAGGCCAACCTAGCCTGGGCCGG + Intergenic
1161011531 19:1961539-1961561 CAGGACAGTGGAGCCTGGGAGGG + Intronic
1161215639 19:3094095-3094117 GAGCGGAGCCGAGCCTGGCCGGG + Intergenic
1161234176 19:3189848-3189870 GAGGGCAGTGTGGCCTTGGCTGG + Intronic
1161285094 19:3464532-3464554 GAGGTCAGTTGGGGCTGGGCTGG - Intronic
1161410621 19:4115246-4115268 GAGGGCAGGCGTGGCTGGGCAGG - Intronic
1161733786 19:5978117-5978139 GAAAGCAGGCGAGCCTGGGCCGG - Exonic
1163100878 19:15095682-15095704 GAGGTCACACCAGCCTGGGCTGG - Intergenic
1163646526 19:18492784-18492806 GAGGGCAGTGGAGCTGGGCCTGG - Intronic
1164669211 19:30063333-30063355 GTGGGCAGGTGAGGCTGGGCAGG - Intergenic
1164746053 19:30614436-30614458 AAGGGCAGTGGGGACTGGGCGGG + Intronic
1165576310 19:36822577-36822599 GACTGCACTCTAGCCTGGGCTGG - Intronic
1166063595 19:40343149-40343171 GAGGGCAGAGGAGCCGGGTCAGG - Intronic
1166863774 19:45824091-45824113 GAGGACAGCCCAGCCAGGGCTGG - Intronic
1166966220 19:46530763-46530785 GAGGGAAGTGGACTCTGGGCTGG - Intronic
1166996026 19:46720093-46720115 GAGGGCAGCACAGCCAGGGCCGG - Exonic
1167597729 19:50436191-50436213 GAGGGGAGTGGAGCTTGTGCAGG + Intronic
1167756466 19:51416282-51416304 GAGGGCCGTCGGGCTGGGGCTGG - Intronic
1168264800 19:55216888-55216910 GAGGGCAGTAGCCCCCGGGCAGG - Intergenic
925368411 2:3326428-3326450 CAGGGCAGTGGAGGCTGGGGAGG - Intronic
927487201 2:23496600-23496622 GGAGGCAGTGCAGCCTGGGCAGG + Intronic
927809426 2:26173304-26173326 CAAGGCAGGCGAGCGTGGGCAGG - Exonic
927853122 2:26512175-26512197 GAGGGCAGGAGAGCCAGGCCAGG + Intronic
927937501 2:27083913-27083935 GGGGACAGGCGGGCCTGGGCAGG + Exonic
929084463 2:38154745-38154767 GAGGGCAGCCCAAGCTGGGCTGG + Intergenic
929597790 2:43187086-43187108 GAGGGCAGGGGAGCCAGGCCTGG - Intergenic
932024046 2:68116004-68116026 GAGGGAAGTGGATGCTGGGCAGG - Intergenic
933972689 2:87483169-87483191 CCGGGCAGTTGACCCTGGGCTGG + Intergenic
935110772 2:100092359-100092381 GAGGGCTGACTAGCCTGGGCCGG - Intronic
935191425 2:100781741-100781763 GAGGGCAGCTGACCCTGGGGAGG - Intergenic
936124200 2:109772803-109772825 GAGGGCTGACTAGCCTGGGCTGG + Intergenic
936220489 2:110598661-110598683 GAGGGCTGACTAGCCTGGGCCGG - Intergenic
936321029 2:111467044-111467066 CCGGGCAGTTGACCCTGGGCTGG - Intergenic
937229215 2:120387753-120387775 GAGAGCAGGCTGGCCTGGGCAGG - Intergenic
938026776 2:127956209-127956231 GAGGGCAGGCGTGCCTGGAGAGG + Intronic
938120160 2:128627382-128627404 GTGGGAAGTCAAGTCTGGGCGGG + Intergenic
938124701 2:128663516-128663538 GATGGCAGGCAATCCTGGGCTGG + Intergenic
939900629 2:147845293-147845315 GAGTCCAGTGGAGCCTGGGGAGG + Intronic
942947170 2:181683770-181683792 GAGGGGAGTGTGGCCTGGGCCGG + Intergenic
946265846 2:218540601-218540623 CAGTGCACTCCAGCCTGGGCTGG + Intronic
947670955 2:231935014-231935036 GACAGCAGTTCAGCCTGGGCAGG + Intergenic
947914116 2:233820709-233820731 CAGAGCAGTGGAGCCTGTGCTGG + Intronic
948479947 2:238242985-238243007 GAGGCCAGCAGAGGCTGGGCAGG + Intergenic
948684947 2:239664511-239664533 GAGGGGTCTCCAGCCTGGGCTGG - Intergenic
1168766245 20:383096-383118 GAGGGCAGTAGGGCATGGTCAGG - Intronic
1170808245 20:19653214-19653236 AAGGGCAGAGGAGCCAGGGCTGG - Intronic
1171202580 20:23254197-23254219 GGGGGCTGTCCAGCCTCGGCAGG + Intergenic
1171312212 20:24153655-24153677 GAGAGCATTGGAGCCTGGACGGG - Intergenic
1171431488 20:25085616-25085638 GCGGGCACTGGAGGCTGGGCAGG - Intergenic
1172033418 20:31996487-31996509 GAGGGCTGTGGAGACAGGGCAGG - Exonic
1172229439 20:33327039-33327061 GATGGCAGTGGGGCCAGGGCTGG - Intergenic
1173669736 20:44790405-44790427 GAGGGTAGAGGAGCCTGGGGAGG - Intronic
1176090423 20:63316130-63316152 GAGGGAAAACGACCCTGGGCGGG + Intronic
1176141384 20:63546589-63546611 GAGGGCAGGTGAGCAGGGGCTGG - Intronic
1177754906 21:25334757-25334779 CTGGGCAGTGGAGACTGGGCTGG + Intergenic
1177892887 21:26827507-26827529 GAGTGCAATCTAGCCTGGGGGGG + Intergenic
1178356375 21:31913300-31913322 GAGGGAATTCCAGGCTGGGCTGG + Intronic
1179924020 21:44522550-44522572 CAGAGCTGTGGAGCCTGGGCAGG + Intronic
1181271547 22:21661486-21661508 CAGGGCAATGGAGCTTGGGCAGG + Intronic
1181671649 22:24428081-24428103 GAGGGAAGTGGAGCCCGTGCTGG + Intronic
1182352932 22:29709052-29709074 GTGGGCAGGGGAGCCTGTGCGGG + Intergenic
1183633150 22:39045610-39045632 GAGGGCAGGAGGGCCTGGCCAGG - Intronic
1184108328 22:42381451-42381473 GAGGGCAGGGCAGGCTGGGCCGG + Exonic
1184656226 22:45943509-45943531 GAGGGCAGGCCACCCTGGGCTGG - Intronic
1184864827 22:47196279-47196301 GAGGGCAGCCCAGCCTGTCCAGG - Intergenic
950421338 3:12901365-12901387 GAGGGCAGGTGGGCCTGGGGAGG + Intronic
950484598 3:13265564-13265586 GTGGGCAGTCCAGGCTGGGTGGG + Intergenic
952777848 3:37063473-37063495 GAGGTCAGAGGAGCCAGGGCAGG + Intronic
953242052 3:41158319-41158341 CATTGCAGTCCAGCCTGGGCAGG + Intergenic
953538528 3:43794126-43794148 GAGGGCACTAGAGGCTGGGGAGG - Intergenic
953668467 3:44943101-44943123 GAGGGCTGAGGAGCCTGGGTAGG - Intronic
953924775 3:46977155-46977177 GAAGGCATTCGAGCCTTGTCAGG - Intronic
960994008 3:123329328-123329350 GAGGGAAGGGGAGCCTGGGCAGG + Intronic
961077035 3:123992030-123992052 GAGAGCAGTAGAACCTCGGCGGG + Intronic
961307541 3:125969270-125969292 GAGAGCAGTAGAACCTCGGCGGG - Exonic
961313316 3:126017477-126017499 GAGGCCAGTGAAGACTGGGCAGG + Intronic
962993847 3:140605471-140605493 GGGGGCAGTGGAGCATGGCCAGG + Intergenic
966258367 3:177945864-177945886 GAGGGCAGAAGAGCCTGGGCTGG - Intergenic
966932948 3:184687541-184687563 CAGGGAAATGGAGCCTGGGCTGG - Intergenic
967990371 3:195125887-195125909 GAGGGCAGTGTTGTCTGGGCGGG - Intronic
968393316 4:211110-211132 GAAGGCAGTCGAGGCTGGTTAGG + Intergenic
968660349 4:1796199-1796221 GAGGGCACCCGAGCCTGAGCTGG - Intronic
969470283 4:7383519-7383541 GAGAGCATTGGAGCCTGGGGAGG + Intronic
969519085 4:7665379-7665401 GAGAGCAGTGGAGACTGGGCAGG - Intronic
969520973 4:7677604-7677626 GTGGCCAGTAGACCCTGGGCAGG + Intronic
969710412 4:8840168-8840190 GAGAGGAGTCGAGCCTGCCCGGG + Intergenic
971163832 4:24161587-24161609 AAGGGGAATGGAGCCTGGGCCGG + Intergenic
971916024 4:32871146-32871168 GAGGGAAATCAAGCCTGGGATGG - Intergenic
972978734 4:44669624-44669646 TAGGGCAATTGAGCTTGGGCCGG - Intronic
973317814 4:48779980-48780002 GCCGGCAGCCCAGCCTGGGCGGG - Intronic
976765406 4:88592885-88592907 GAGGGCGGCCGAGCGCGGGCGGG - Intronic
982745934 4:159103822-159103844 GAGGCGTGTCGAGCCAGGGCCGG + Intergenic
984432334 4:179664950-179664972 CAGGACAGTCGAGCCTGGGAGGG - Intergenic
985675486 5:1229476-1229498 GAGGGCCATTGAGCCTGGGCTGG - Intronic
987031259 5:13978957-13978979 GAGGGCAGAGGAGGCTGGCCAGG - Intergenic
993877556 5:93326156-93326178 GATAGCAGACGAGCCAGGGCCGG - Intergenic
997976600 5:138444992-138445014 GATAGCAGTAGAGCCTGGACTGG - Intronic
998094073 5:139387614-139387636 CAGGGCACTCGGGCCTGGGTGGG - Exonic
1001065281 5:168530513-168530535 GATGGCAGGCGAGCCTGAGCTGG - Exonic
1001618026 5:173057488-173057510 GAGGGCAGTCAAGCCTCCCCTGG + Intronic
1002312891 5:178325334-178325356 GAGGGAAGTCCAGGCTGGCCAGG - Intronic
1002435819 5:179230173-179230195 GAGGGCAGGGCAGGCTGGGCAGG + Intronic
1002795316 6:466855-466877 AATGGCACTCGAGCCTGCGCCGG + Intergenic
1004253344 6:14040836-14040858 GGGAGCAGTTGAGCCTGTGCAGG + Intergenic
1006155474 6:32010876-32010898 GAGGCCAGTGGAGTCTGGGGAGG - Intergenic
1006161780 6:32043610-32043632 GAGGCCAGTGGAGTCTGGGGAGG - Intronic
1006396075 6:33788596-33788618 GAAGGCAGCCGCGCCGGGGCGGG + Exonic
1006682275 6:35805645-35805667 GAGGGCAGCAGGCCCTGGGCTGG - Exonic
1006729084 6:36222202-36222224 AAGGGCACTCGAGACAGGGCTGG - Exonic
1006813997 6:36838878-36838900 GAGGGTGGACGAGCCTGGGAGGG + Intronic
1007416996 6:41697115-41697137 GAGGGCAGACCAGCCTGGCATGG + Intronic
1007721436 6:43887637-43887659 GTGGGCTGTGCAGCCTGGGCTGG + Intergenic
1008882997 6:56400360-56400382 GAGGGCAGTGGCTCCTGTGCAGG + Intergenic
1014073244 6:117207205-117207227 GAGGGCTGGCAAGCATGGGCTGG + Intergenic
1015786434 6:136923848-136923870 GAGGACGGCCGAGCCCGGGCGGG - Intronic
1016172178 6:141031596-141031618 CAGTGCACTCCAGCCTGGGCAGG + Intergenic
1018619333 6:165715019-165715041 CAGGGCAGGAGTGCCTGGGCAGG + Intronic
1019057044 6:169231492-169231514 GAAAGCAGTCCAGCCTGGGATGG + Intronic
1019174668 6:170154047-170154069 GAGAGCAGGCAGGCCTGGGCTGG - Intergenic
1019305698 7:333256-333278 GAGGGCAGGCGGCGCTGGGCGGG - Intergenic
1019313358 7:373523-373545 GTGGGCACCCGAGACTGGGCCGG + Intergenic
1019390908 7:786684-786706 GAGGGCAGGCCAGCCTTGGGGGG + Intergenic
1019549913 7:1596919-1596941 GGGCGCAATCGTGCCTGGGCGGG + Intergenic
1019774866 7:2906464-2906486 GGGGACAGTCGTGCCTGGGGAGG - Exonic
1023521161 7:41051324-41051346 GAGGGCAGTTGAGCCTTTGCAGG + Intergenic
1024019121 7:45349179-45349201 CTGGGCAGAAGAGCCTGGGCTGG + Intergenic
1026746651 7:73018340-73018362 GAGGGCAGCCTAGCGGGGGCTGG + Intergenic
1026750303 7:73046483-73046505 GAGGGCAGCCTAGCGGGGGCTGG + Intergenic
1026753950 7:73074593-73074615 GAGGGCAGCCTAGCGGGGGCTGG + Intergenic
1026757601 7:73102629-73102651 GAGGGCAGCCTAGCGGGGGCTGG + Intergenic
1027032755 7:74902898-74902920 GAGGGCAGCCTAGCGGGGGCTGG + Intergenic
1027089802 7:75290857-75290879 GAGGGCAGCCTAGCGGGGGCTGG - Intergenic
1027093447 7:75318785-75318807 GAGGGCAGCCTAGCGGGGGCTGG - Intergenic
1027097090 7:75346752-75346774 GAGGGCAGCCTAGCGGGGGCTGG - Intergenic
1027322257 7:77020918-77020940 GAGGGCAGCCTAGCGGGGGCTGG + Intergenic
1027409095 7:77894727-77894749 GAGGGGAGACAAGCCTGGGGAGG + Intronic
1029278981 7:99424770-99424792 GAGTGGACTCGGGCCTGGGCAGG - Intronic
1029283403 7:99450832-99450854 GAGGGCAGCAGGGCCTGGGCCGG - Intronic
1029398201 7:100323753-100323775 GAGGGCAGCCTAGCGGGGGCTGG - Intergenic
1029620626 7:101688119-101688141 GAGGGATGTCCAGCCTGGGCAGG - Intergenic
1031987644 7:128173544-128173566 TAAGGCAGGCGAGGCTGGGCTGG - Intergenic
1032217831 7:129971033-129971055 GAGGGCAGCCAAGGCTGGGGAGG + Intergenic
1032383575 7:131506549-131506571 GAGGGCAAGGGGGCCTGGGCTGG - Intronic
1035445978 7:158943558-158943580 GAAGGCAGCAGGGCCTGGGCAGG + Intronic
1035730877 8:1852978-1853000 GAGGGCAGCCTGTCCTGGGCAGG + Intronic
1036175887 8:6538317-6538339 GAGGACAGTGGACCCTGGGCGGG - Intronic
1036632730 8:10526466-10526488 GAGTGCAGTGGACCCTAGGCTGG - Intronic
1036664733 8:10730860-10730882 GAGGGCGGTGGAGTCTGGCCCGG - Intronic
1047614288 8:126550499-126550521 AATGGCACTCCAGCCTGGGCAGG - Intergenic
1048971098 8:139645369-139645391 GAGGGCAGGTGGGCATGGGCAGG - Intronic
1048985773 8:139733960-139733982 GAGGGCAGTGGAACCCAGGCAGG - Intronic
1049422775 8:142524312-142524334 GTGGGGAGTGGGGCCTGGGCGGG - Intronic
1049437427 8:142594242-142594264 GAGGGCAGGGGTGCCTGGCCTGG + Intergenic
1049704561 8:144035178-144035200 GAGGGCAGGCGGGCCTGGGGAGG - Intronic
1052832771 9:33229416-33229438 GTGGGCAGGAGACCCTGGGCAGG + Intronic
1053175321 9:35918170-35918192 GAGGGCAGAGGAGTCAGGGCAGG + Intergenic
1057442416 9:95091787-95091809 GCCGGCAGCCGAGCCTGGGGTGG + Intergenic
1057805147 9:98214774-98214796 GAGGGCAGCAGCCCCTGGGCAGG - Intronic
1058625494 9:106929153-106929175 GAGGGGAGTCGTCCTTGGGCGGG - Exonic
1059365094 9:113780781-113780803 GAGGGCAGTGGAACCAGTGCTGG - Intergenic
1060195370 9:121620229-121620251 GAGGGCAGGGGTGCCTGGCCAGG - Intronic
1062281967 9:135756218-135756240 GAGAGCAGTAGAGCCTGGGTCGG - Intronic
1062340540 9:136092143-136092165 GTGGGCAGTCGGGCCTTGGGTGG - Intronic
1062344505 9:136108680-136108702 GAGCTCAATCAAGCCTGGGCTGG - Intergenic
1190415712 X:50178537-50178559 CAGAGCAGGAGAGCCTGGGCTGG - Intergenic
1190848385 X:54215238-54215260 CAGTACAGTCCAGCCTGGGCTGG - Intronic
1195165384 X:102214956-102214978 GAGGGGTTCCGAGCCTGGGCGGG + Intergenic
1195193474 X:102472135-102472157 GAGGGGTTCCGAGCCTGGGCGGG - Intergenic
1195676482 X:107511052-107511074 CAGGCCAGTCTAGCCTGAGCTGG - Intergenic
1199679719 X:150216236-150216258 GAGGTCAGTCAAGCCTGAACTGG - Intergenic
1199695512 X:150340813-150340835 GAGGTCAGTCAAGCCTGAACTGG + Intergenic
1200116912 X:153773486-153773508 GATGGCAGTCGGGTGTGGGCGGG - Intronic
1201762772 Y:17557881-17557903 GAGGTCAGACGAGACTGGACAGG - Intergenic
1201838780 Y:18348108-18348130 GAGGTCAGACGAGACTGGACAGG + Intergenic