ID: 1067693541

View in Genome Browser
Species Human (GRCh38)
Location 10:48519715-48519737
Sequence GCCTGAGGGCAGTCGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067693541_1067693552 28 Left 1067693541 10:48519715-48519737 CCCAGGCTCGACTGCCCTCAGGC 0: 1
1: 1
2: 2
3: 11
4: 203
Right 1067693552 10:48519766-48519788 GTGTGGTGCGGAAACCAGAGAGG No data
1067693541_1067693549 6 Left 1067693541 10:48519715-48519737 CCCAGGCTCGACTGCCCTCAGGC 0: 1
1: 1
2: 2
3: 11
4: 203
Right 1067693549 10:48519744-48519766 GATGGCATCTTGAGAGGAAGTGG No data
1067693541_1067693551 16 Left 1067693541 10:48519715-48519737 CCCAGGCTCGACTGCCCTCAGGC 0: 1
1: 1
2: 2
3: 11
4: 203
Right 1067693551 10:48519754-48519776 TGAGAGGAAGTGGTGTGGTGCGG No data
1067693541_1067693550 11 Left 1067693541 10:48519715-48519737 CCCAGGCTCGACTGCCCTCAGGC 0: 1
1: 1
2: 2
3: 11
4: 203
Right 1067693550 10:48519749-48519771 CATCTTGAGAGGAAGTGGTGTGG No data
1067693541_1067693548 0 Left 1067693541 10:48519715-48519737 CCCAGGCTCGACTGCCCTCAGGC 0: 1
1: 1
2: 2
3: 11
4: 203
Right 1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067693541 Original CRISPR GCCTGAGGGCAGTCGAGCCT GGG (reversed) Intronic
900396426 1:2454965-2454987 GCCTGGGGGCAGCCAGGCCTCGG + Intronic
902235220 1:15053084-15053106 GCATGATGGCAGACCAGCCTGGG + Intronic
902276660 1:15344949-15344971 GGCTGTGGGCAGCAGAGCCTAGG - Intronic
902470769 1:16646541-16646563 GACTGGGGGCAGGGGAGCCTGGG + Intergenic
902488032 1:16760907-16760929 GACTGGGGGCAGGGGAGCCTGGG - Intronic
903967082 1:27097561-27097583 ACCAGAGGGCAGTGGGGCCTTGG - Intergenic
904338353 1:29812410-29812432 GGCTGCTGGCAGTGGAGCCTGGG - Intergenic
905150431 1:35922755-35922777 GCTTGAGGGCAGTCCAGCCCAGG - Exonic
905253026 1:36661858-36661880 GGCTAAGGGCAGTGGATCCTGGG + Intergenic
912432296 1:109635088-109635110 TCCTGAGTGAAGTCGACCCTGGG + Intergenic
914922810 1:151859092-151859114 TCCTGAGGGCAGGGCAGCCTTGG - Intergenic
915273111 1:154769168-154769190 GCCTGAGGGAAGGAGAGCCCGGG - Intronic
915331386 1:155114888-155114910 GTCTGAGTGCACTCCAGCCTGGG - Intergenic
917542604 1:175929370-175929392 GCCTGGGTGCACTCCAGCCTGGG - Intergenic
919938600 1:202271285-202271307 GCCAGATGGCAGGGGAGCCTAGG + Intronic
919940095 1:202280575-202280597 GCCTGTGGTCAATCCAGCCTTGG + Intronic
920383842 1:205553131-205553153 GCCTGGGTGCACTCCAGCCTGGG + Intergenic
922911950 1:229225660-229225682 GCAGGAGGGCACTAGAGCCTTGG - Intergenic
922985043 1:229859967-229859989 GGTTGAGGGCAGACGACCCTGGG - Intergenic
1063450050 10:6145071-6145093 GCCTGTGGGTACCCGAGCCTTGG + Intronic
1067539893 10:47143785-47143807 GCCAGAGGGCAGGGGGGCCTGGG + Intergenic
1067693541 10:48519715-48519737 GCCTGAGGGCAGTCGAGCCTGGG - Intronic
1069608650 10:69757551-69757573 CCCAGAGGGCAGCTGAGCCTGGG - Intergenic
1070350866 10:75591148-75591170 GCTTGAGGCCAGACCAGCCTGGG + Intronic
1071301215 10:84257374-84257396 GCCTGAGGGCAGCTCAGCCTGGG + Intronic
1072728271 10:97828095-97828117 GCCTGGGGGCCCTGGAGCCTGGG + Intergenic
1072734518 10:97869810-97869832 GCCCCTGGGCTGTCGAGCCTGGG + Exonic
1073755045 10:106572544-106572566 GCCAGTGGGCCGTGGAGCCTGGG - Intergenic
1075483258 10:122800068-122800090 GCCTGGGGGCAGGAGAGCCTGGG + Intergenic
1075483315 10:122800210-122800232 CCCTGGGGGCAGGAGAGCCTGGG + Intergenic
1075483351 10:122800291-122800313 GCCTGGGGGCAGGAGAGCCTGGG + Intergenic
1075483384 10:122800371-122800393 GCCTGGGGGTAGGAGAGCCTGGG + Intergenic
1075483389 10:122800387-122800409 GCCTGGGGGCAGTAGAGCCTGGG + Intergenic
1075483397 10:122800403-122800425 GCCTGGGGGCAGGGGAGCCTGGG + Intergenic
1076566485 10:131403014-131403036 GCCCCAGGGCAGCCCAGCCTGGG + Intergenic
1077327848 11:1971404-1971426 GGCTCAGGGCAGCCGAGCCAGGG - Intronic
1078673032 11:13381902-13381924 GCCTGATGCCAGTAGAGCTTAGG + Intronic
1079837419 11:25351255-25351277 GCCTGAGGGCAGCAGAAGCTGGG + Intergenic
1081424081 11:42905599-42905621 GCCCCAGGGCACTCCAGCCTGGG + Intergenic
1082278879 11:50248072-50248094 GCCCGACGGCACTCCAGCCTTGG + Intergenic
1084172388 11:67406760-67406782 GACTGAGGGAGGTTGAGCCTGGG + Intronic
1084848407 11:71918953-71918975 TCCTGAGGGCAGCCGAGCCAAGG + Exonic
1087532902 11:99406907-99406929 GCTTGAGGTCTGTCTAGCCTGGG + Intronic
1087634504 11:100687432-100687454 ACCTGAGGGGACTCGCGCCTCGG + Intergenic
1088535326 11:110854073-110854095 GGCTTAGGGCAGTTCAGCCTAGG - Intergenic
1088746282 11:112807666-112807688 CACTCAGGGCAGTTGAGCCTGGG + Intergenic
1090024931 11:123159432-123159454 TCCTGTGGGCAGGCAAGCCTGGG + Intronic
1202810828 11_KI270721v1_random:26584-26606 GGCTCAGGGCAGCCGAGCCAGGG - Intergenic
1091650289 12:2304287-2304309 GCTGGAGGGCGGTCCAGCCTAGG + Intronic
1095929697 12:47613209-47613231 ACCTGAGGCCATTTGAGCCTGGG - Intergenic
1096666729 12:53171203-53171225 GCCTGGGGGCAGGCTGGCCTTGG + Intronic
1096683357 12:53271638-53271660 GCAAGAGGGCACTCCAGCCTGGG + Intronic
1096839457 12:54371429-54371451 GCCTGAGGACAGGAGAGTCTGGG + Intronic
1098680869 12:73352432-73352454 GCGTGATGGCACTCCAGCCTGGG - Intergenic
1099684511 12:85867405-85867427 GCCTGAGGGGAGTCAAAGCTTGG - Intergenic
1100324428 12:93527672-93527694 GCATGATGGCACTCCAGCCTGGG + Intergenic
1101071754 12:101082633-101082655 CCCTGAGGGAAGTCCAGCCTTGG + Intronic
1101464370 12:104932580-104932602 GCCTCACTGCAGTCCAGCCTGGG + Intronic
1102056491 12:109900372-109900394 GCCTGCGGGAAGTCGGGCCGGGG + Intronic
1104419180 12:128621142-128621164 GCCAGAGGGCAAGGGAGCCTGGG - Intronic
1106328252 13:28715410-28715432 GACTGAGGGAAGACGGGCCTTGG - Intronic
1107657178 13:42603618-42603640 GCCAGAGGACAGTGGGGCCTTGG - Intronic
1108854460 13:54775646-54775668 GCCTGAGGGCAGCTCAGCATAGG - Intergenic
1109423483 13:62144194-62144216 GCCTGACTGCATTCCAGCCTGGG - Intergenic
1110338032 13:74354650-74354672 GCCTCACTGCAGTCCAGCCTGGG + Intergenic
1117062479 14:51977345-51977367 GCTTGAGCCCAGTCCAGCCTGGG + Intronic
1118984432 14:70741654-70741676 CCCTGAGTGCAGTTGAGACTGGG - Intronic
1119624465 14:76160099-76160121 ACTTGAGTGCACTCGAGCCTGGG + Intronic
1121100317 14:91245688-91245710 GAGTGAGGGCAGTGGAGCCAAGG - Intronic
1123008134 14:105334117-105334139 GCCTGTGGGCAGTCACGCCAAGG - Intronic
1129413900 15:75364239-75364261 CCCTGAGATCAGTGGAGCCTAGG - Intronic
1129680796 15:77657363-77657385 GCCTGAGGGCAGTGAAGGTTGGG + Intronic
1130847395 15:87759963-87759985 GCCAGAGGGCAAGCGAGTCTGGG - Intergenic
1131151430 15:90049707-90049729 ACCAGAGGGCAGTGGGGCCTGGG - Intronic
1132017384 15:98330887-98330909 GTCTGTGGGCAGACAAGCCTTGG + Intergenic
1132053932 15:98634926-98634948 GCCTCAGGACAGTGGAGGCTGGG - Intergenic
1132567804 16:631235-631257 GCATGAGGGCCGCCGAGCCAGGG - Exonic
1132680729 16:1140678-1140700 GTCTGAGGGCAGCCGTCCCTGGG - Intergenic
1132903450 16:2270627-2270649 GGCTGAGGGCAGTGGAGCTGGGG + Intergenic
1133295031 16:4747525-4747547 GCCTCTTGGGAGTCGAGCCTGGG - Exonic
1135193656 16:20376510-20376532 GCCTGTTGGCAGTTGAACCTTGG - Intronic
1135576060 16:23586689-23586711 GCGTGATTGCAGTCCAGCCTAGG - Intronic
1135770287 16:25213042-25213064 ACCTGACTGCAATCGAGCCTGGG - Intergenic
1136656315 16:31711395-31711417 GCCTGAGGGCAGACAGGCCAGGG - Intergenic
1138281477 16:55775031-55775053 GCATGACGGCACTCCAGCCTGGG + Intergenic
1139506665 16:67401439-67401461 GCCTGAGGTCAGACCAGCCAGGG - Intronic
1139589692 16:67926748-67926770 GGCTGAGGGCAGGCGATCCCGGG - Intronic
1139597636 16:67967716-67967738 GCCCAGGGGCAGTCAAGCCTGGG - Intronic
1140428630 16:74882765-74882787 GCATGATTGCAGTCCAGCCTCGG + Intronic
1141159724 16:81621216-81621238 CCCTGAGGGGAGTCCAGCCGGGG + Intronic
1142904406 17:3032777-3032799 GCCTGAGGGCAGGGGAGCAAGGG - Intronic
1143185021 17:5004803-5004825 GCCTGGGGGCAGGGGACCCTTGG - Intronic
1143460814 17:7102288-7102310 GCCTGAGGGCAGATCAGGCTGGG - Intronic
1144021854 17:11244968-11244990 GGCGGAGGGCTGTCCAGCCTGGG - Intronic
1144504314 17:15817289-15817311 GCCTGCGGGCAGTGGAGCTGCGG + Intergenic
1144634067 17:16892957-16892979 GCCTGCGGGCAGTGGAGCTGCGG + Intergenic
1145168171 17:20632798-20632820 GCCTGCGGGCAGTGGAGCTGCGG + Intergenic
1147433036 17:40385774-40385796 GCCTGAGCTCAGACCAGCCTGGG + Intergenic
1147673965 17:42192527-42192549 GGCTGAGGGCACTGGAGGCTGGG - Exonic
1148287205 17:46404825-46404847 GCACCAGGGCAGTCCAGCCTGGG + Intergenic
1148309375 17:46622413-46622435 GCACCAGGGCAGTCCAGCCTGGG + Intronic
1149162244 17:53708266-53708288 GCGTAAGGGCACTCCAGCCTGGG - Intergenic
1149924773 17:60692280-60692302 GCCTGGGTGCACTCCAGCCTGGG - Intronic
1151570781 17:74924347-74924369 GCCGGAGGGCAGTCGGACTTGGG + Intronic
1152421111 17:80193691-80193713 GCCAGGGGGCAGGTGAGCCTGGG - Intronic
1153964003 18:10164652-10164674 GACTGCAGGCTGTCGAGCCTTGG - Intergenic
1154356819 18:13627844-13627866 GCCAGAGGGCAGACGGTCCTGGG + Intronic
1155213033 18:23619286-23619308 GCCTGAGGGCGGTAGAGACGGGG - Intronic
1157770407 18:50340304-50340326 GCCCGAGGGCAGGCGAGACAAGG + Intergenic
1160239787 18:77114891-77114913 GCCTGGGGGCAGACGTGCCTGGG + Intronic
1161410623 19:4115250-4115272 ACCTGAGGGCAGGCGTGGCTGGG - Intronic
1161424303 19:4194203-4194225 ACCTGAGAGCACTCCAGCCTGGG - Intronic
1161742302 19:6029613-6029635 GCCTGAGAACTGTTGAGCCTGGG + Intronic
1162501882 19:11058729-11058751 GCCTGCGGGCAGGCGAGGCGGGG + Intronic
1163250318 19:16122881-16122903 GCCTGAGGGCACTGGGGTCTTGG + Intronic
1163700317 19:18783545-18783567 GGCTGAGGTCAGTTGAGTCTGGG - Intronic
1163751103 19:19078363-19078385 GCCTGAGCTCACTCCAGCCTTGG + Intronic
1164669213 19:30063337-30063359 GCCTGTGGGCAGGTGAGGCTGGG - Intergenic
1167378473 19:49125231-49125253 GCCTGAGGGCCGTGGGCCCTGGG - Intronic
1168192628 19:54750866-54750888 GCCAGAGAGCAGCCCAGCCTGGG + Intronic
1202703167 1_KI270713v1_random:3333-3355 GACTGGGGGCAGGGGAGCCTGGG + Intergenic
926312061 2:11682052-11682074 GCCTGAAGGCACTGGCGCCTGGG + Intronic
927843148 2:26457813-26457835 GCCTGTGGGCTGGGGAGCCTTGG - Exonic
931285532 2:60828710-60828732 GCCTGAGCTCAGTCCTGCCTGGG - Intergenic
934524492 2:95043195-95043217 GCATAGGGTCAGTCGAGCCTTGG - Intronic
936335474 2:111585358-111585380 GCCTGAGAACAGTCCAGCCAGGG - Intergenic
940133628 2:150411946-150411968 GCCTCAGGGCTGGCAAGCCTTGG - Intergenic
941661848 2:168203406-168203428 TCCTGAGGGCAGTTGATTCTTGG - Intronic
942613183 2:177762905-177762927 GCAGGAGGGAAGACGAGCCTGGG + Intronic
947247591 2:228066611-228066633 GCGTGGGGGCAGTGGAGCCAGGG + Intronic
1172307251 20:33889377-33889399 GCATGAGAGCAGGGGAGCCTAGG + Intergenic
1172528594 20:35616141-35616163 GCCCGAGGGCAGAAGAGCCCGGG + Exonic
1172663195 20:36581444-36581466 TCCTGAGGGCAGTAGAGTCCAGG - Intronic
1177344936 21:19855673-19855695 GACTGAGGGCAGCTGAGCGTGGG - Intergenic
1177393746 21:20507878-20507900 GCCTGAGGGCAGTGGTGGCAGGG + Intergenic
1180207231 21:46268553-46268575 CCCTGAGGCCAGGCGAGGCTTGG - Intronic
1181468131 22:23121413-23121435 GCCTGAGGGCAGGGGTGCCCAGG - Intronic
1181669557 22:24419814-24419836 CCCTGAGGGGAGTGGAGCCCTGG - Intronic
1181694463 22:24585963-24585985 GCCTGAGGGCAGTGCGGCCGGGG - Exonic
1181854539 22:25772543-25772565 GGCTGAGGGCAGGGGGGCCTGGG + Intronic
1182484027 22:30628558-30628580 GCCTGAGGGCAGTGGAGGTGAGG - Intergenic
1182787265 22:32918088-32918110 GGCTGAGGGGAGTCAGGCCTTGG - Intronic
1183587461 22:38761126-38761148 GGCTGAGGGCATTTGAACCTGGG + Intronic
1185139169 22:49090709-49090731 GCCCGAGAGCAGACCAGCCTGGG + Intergenic
949281133 3:2348450-2348472 GCCTGAGGGCTGGTGAGCCAGGG - Intronic
950421336 3:12901361-12901383 GGCTGAGGGCAGGTGGGCCTGGG + Intronic
950492804 3:13316476-13316498 CCCTGAGGGTAGCCCAGCCTCGG + Exonic
950719214 3:14870603-14870625 GTCTGGGGGCGGTGGAGCCTTGG - Intronic
951305351 3:21053742-21053764 AACTGAGGGCAGTTGAGCCTTGG + Intergenic
952735607 3:36689047-36689069 GCCAGAGGGCAAACGAACCTGGG - Intergenic
954024968 3:47775749-47775771 GCCTGGGTGCACTCCAGCCTGGG + Intronic
961328237 3:126124259-126124281 GCGTGAGGGCAGAGTAGCCTGGG - Intronic
961403911 3:126665879-126665901 GCTTGAGGGCAGCCTGGCCTAGG + Intergenic
961563308 3:127746388-127746410 GCCTGGGGGCAGTTGAGGCAGGG - Intronic
961992568 3:131207534-131207556 GCCTGGGTGCACTCCAGCCTGGG + Intronic
964416268 3:156451678-156451700 GAGTGAGAGCAGTAGAGCCTGGG - Intronic
966865186 3:184254910-184254932 GCCTGAGGGAAGTAGAGCCTTGG - Intronic
969866410 4:10079471-10079493 GCCTGTGGGAACTGGAGCCTTGG - Intronic
970860567 4:20698136-20698158 ACCAGAGGGCACTGGAGCCTGGG + Intronic
971190511 4:24424316-24424338 GCTCCAGGGCACTCGAGCCTGGG - Intergenic
971819302 4:31530740-31530762 GCCTGAGGGCAGTAGGGGCAGGG + Intergenic
972319505 4:37960252-37960274 GCCTGAGGTCAGACAAACCTGGG - Intronic
972515185 4:39804868-39804890 GCATGACTGCACTCGAGCCTGGG - Intergenic
972614645 4:40686404-40686426 GCTTGAGGCCAGGCCAGCCTGGG - Intergenic
972903221 4:43711208-43711230 GCATCAGGGCACTCCAGCCTGGG - Intergenic
979308625 4:119176012-119176034 TCCTGAGTGCAGAGGAGCCTAGG - Intronic
983934797 4:173494181-173494203 GCCGGTGGGCACTCGCGCCTGGG - Intergenic
984182412 4:176500295-176500317 GCCCCAGTGCAGTCCAGCCTAGG - Intergenic
987928100 5:24367250-24367272 TCCTGAGAGCAGTGGAGCTTTGG - Intergenic
990431573 5:55740210-55740232 GCATGAGTGCACTCCAGCCTGGG - Intronic
992085584 5:73275329-73275351 GGATGAGGGCAGAGGAGCCTTGG + Intergenic
995788384 5:115856473-115856495 GCATCAGGGCATTCCAGCCTGGG - Intronic
998094076 5:139387618-139387640 GCCTCAGGGCACTCGGGCCTGGG - Exonic
1000341191 5:160278565-160278587 GTCTGAGGGCAGCACAGCCTCGG - Intronic
1001285983 5:170424476-170424498 GCCTGAGGTGTGTGGAGCCTCGG - Intronic
1002160236 5:177310612-177310634 GCCAGAGGGCAGTGGCCCCTGGG + Intronic
1004482483 6:16033980-16034002 ACCTGAGAGGAGTTGAGCCTTGG - Intergenic
1005657262 6:27953569-27953591 GCTTGAGTCCAGTCCAGCCTGGG - Intergenic
1013192302 6:107813969-107813991 GCCTCAGGGCAGTGGTGCCCAGG + Intronic
1019139783 6:169936057-169936079 GCCTGGGGGCAGGCAGGCCTGGG - Intergenic
1019390904 7:786680-786702 GGGTGAGGGCAGGCCAGCCTTGG + Intergenic
1019390963 7:786845-786867 GGGTGAGGGCAGGCCAGCCTTGG + Intergenic
1021411071 7:20330721-20330743 GCCTGCGGGCAGCCGAGGCGAGG + Intronic
1023843277 7:44108249-44108271 GCCTGAGGGCAGAGGAGACAGGG - Intronic
1025018665 7:55463800-55463822 GCCTGAGGGCAGGCCCGCCCTGG - Intronic
1027985172 7:85278372-85278394 GCCTGGGTGCACTCCAGCCTGGG - Intergenic
1029414845 7:100436211-100436233 GGCTGAGGGCTGTCGGGCCGCGG + Exonic
1029598667 7:101551042-101551064 GCCAGAGGGCACTGGAGACTTGG + Intronic
1031495885 7:122447594-122447616 GCCTGACTGCACTCCAGCCTAGG - Intronic
1033282835 7:140017897-140017919 GCGTGAGAGCAGGCCAGCCTGGG + Intronic
1035278673 7:157763751-157763773 TCCTGAGGGCAGGAGAGCCCCGG + Intronic
1035424291 7:158757432-158757454 CCCTTAGGGCAGTGGAGCCAGGG + Intronic
1035573388 8:688399-688421 GCCGGAGGGAAGCGGAGCCTGGG - Intronic
1037920383 8:22801553-22801575 GCCTGAAGGCAGTAGAGGCCAGG - Intronic
1040008456 8:42640829-42640851 ACCAGAGGGCAGGGGAGCCTGGG + Intergenic
1041247185 8:55899856-55899878 GCCTGAGCTCAGACCAGCCTAGG - Intronic
1042362841 8:67902190-67902212 AGCTGAGGGCAGATGAGCCTGGG - Intergenic
1046983719 8:120364245-120364267 GCCTGAGGGCAGTGGAGCCTGGG - Intronic
1049579457 8:143404741-143404763 GCCAGAGGGAACTGGAGCCTTGG - Intergenic
1051448182 9:17164267-17164289 GCCTGACTGCACTCCAGCCTGGG + Intronic
1056510582 9:87301186-87301208 GCATGAGCCCAGTCAAGCCTTGG + Intergenic
1057559137 9:96113668-96113690 GGCTGAGATCAGTTGAGCCTGGG + Intronic
1058980168 9:110161581-110161603 GCCTAAGGGTAGTCTTGCCTAGG - Intronic
1061252846 9:129436717-129436739 GCCTGAAGGCAGCCTAGCGTGGG - Intergenic
1061520502 9:131114766-131114788 GTCTGAGGGCAGTGGTGCCAGGG - Intronic
1185573955 X:1155719-1155741 GCATGACGGCACTCCAGCCTGGG - Intergenic
1190244061 X:48679070-48679092 GCCTCAGTGCACTCTAGCCTGGG - Intronic
1191722828 X:64248868-64248890 GCCTGCTGGCAGTGCAGCCTTGG - Intergenic
1193276169 X:79590426-79590448 GCCTGCTTGCAGTCCAGCCTAGG - Intergenic
1195131483 X:101858285-101858307 GCCACAGGGCTGTAGAGCCTAGG - Intergenic
1197623819 X:128781126-128781148 GCCTGAGGGCAGTAGGGGCGGGG - Intergenic
1197726557 X:129780733-129780755 GCCTGAGGCCATTCCAGTCTTGG + Intronic
1198076145 X:133194940-133194962 GCCAGAGGGCAGAAGAGCCTTGG + Intergenic
1198506248 X:137303927-137303949 GCCTGAGGCCAGGCGAGGGTAGG + Intergenic
1200105720 X:153710971-153710993 GCTTCCGGGCAGTCGAGCTTGGG - Intronic
1200163111 X:154019281-154019303 GCCTCGGGGCAGTGGTGCCTGGG + Exonic
1200761541 Y:7043481-7043503 ACCCGAGGGCACTCCAGCCTGGG + Intronic
1201269312 Y:12239122-12239144 GCAGGAGGGCACTTGAGCCTGGG + Intergenic