ID: 1067693542

View in Genome Browser
Species Human (GRCh38)
Location 10:48519716-48519738
Sequence GGCCTGAGGGCAGTCGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067693542_1067693550 10 Left 1067693542 10:48519716-48519738 CCAGGCTCGACTGCCCTCAGGCC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1067693550 10:48519749-48519771 CATCTTGAGAGGAAGTGGTGTGG No data
1067693542_1067693552 27 Left 1067693542 10:48519716-48519738 CCAGGCTCGACTGCCCTCAGGCC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1067693552 10:48519766-48519788 GTGTGGTGCGGAAACCAGAGAGG No data
1067693542_1067693553 30 Left 1067693542 10:48519716-48519738 CCAGGCTCGACTGCCCTCAGGCC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1067693553 10:48519769-48519791 TGGTGCGGAAACCAGAGAGGTGG No data
1067693542_1067693551 15 Left 1067693542 10:48519716-48519738 CCAGGCTCGACTGCCCTCAGGCC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1067693551 10:48519754-48519776 TGAGAGGAAGTGGTGTGGTGCGG No data
1067693542_1067693548 -1 Left 1067693542 10:48519716-48519738 CCAGGCTCGACTGCCCTCAGGCC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG No data
1067693542_1067693549 5 Left 1067693542 10:48519716-48519738 CCAGGCTCGACTGCCCTCAGGCC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1067693549 10:48519744-48519766 GATGGCATCTTGAGAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067693542 Original CRISPR GGCCTGAGGGCAGTCGAGCC TGG (reversed) Intronic
900095319 1:937789-937811 GGCCTGACAGCAGCCGGGCCAGG + Intronic
900115560 1:1026447-1026469 GGCCAGAGGTCATTCCAGCCAGG + Intronic
900538647 1:3191750-3191772 GGGGTGAGGGCAGCCCAGCCAGG + Intronic
900613800 1:3555354-3555376 GGCCTGAGGCCATGCCAGCCTGG - Intronic
902879095 1:19359372-19359394 GGAGTGAGGGCAGACCAGCCAGG - Intronic
902914419 1:19627924-19627946 GCCCAGAGGGCAGAGGAGCCTGG - Exonic
903778126 1:25806135-25806157 GGCCTGAAGGCAGGAGTGCCAGG + Intronic
904033569 1:27547686-27547708 GGGCTGCGGGCAGCTGAGCCTGG + Exonic
904396279 1:30224599-30224621 GGGCTGAGGGCAGGCGAGGAGGG - Intergenic
905390866 1:37634654-37634676 GGGCGGAGCGCAGGCGAGCCGGG - Exonic
906586521 1:46983719-46983741 AGCCTGAGGGCAGTAGAGGTGGG + Intergenic
907072415 1:51548634-51548656 GGACTGAGGGAGGTCGAGGCAGG - Intergenic
912432295 1:109635087-109635109 GTCCTGAGTGAAGTCGACCCTGG + Intergenic
913671056 1:121097657-121097679 GGCCCGAGAGCAGGCGGGCCCGG - Intergenic
915273112 1:154769169-154769191 TGCCTGAGGGAAGGAGAGCCCGG - Intronic
915323596 1:155069548-155069570 GGCCTGAGGGCAGTAGATTGGGG - Intronic
915331387 1:155114889-155114911 GGTCTGAGTGCACTCCAGCCTGG - Intergenic
917977707 1:180250956-180250978 GGGCTTGGGGCAGTGGAGCCAGG - Intronic
918011490 1:180591233-180591255 GGCAGGAGGGCACTCTAGCCAGG - Intergenic
920196241 1:204229031-204229053 GCCCTGCGGGCAGAGGAGCCTGG - Exonic
920218472 1:204378059-204378081 GGCTGGAGGGCAGCAGAGCCAGG - Intergenic
921138821 1:212285977-212285999 GGCCGGAGGGCCGTGGGGCCGGG + Exonic
1067693542 10:48519716-48519738 GGCCTGAGGGCAGTCGAGCCTGG - Intronic
1067756896 10:49012112-49012134 ATCCTGAGGGCAGTCGGGGCAGG + Intergenic
1069769038 10:70886116-70886138 GGCCTATCGGCAGACGAGCCTGG - Intronic
1070406747 10:76104354-76104376 AGCCAGAGGGCAATGGAGCCTGG - Intronic
1071301214 10:84257373-84257395 GGCCTGAGGGCAGCTCAGCCTGG + Intronic
1075483257 10:122800067-122800089 GGCCTGGGGGCAGGAGAGCCTGG + Intergenic
1075483350 10:122800290-122800312 GGCCTGGGGGCAGGAGAGCCTGG + Intergenic
1075483383 10:122800370-122800392 GGCCTGGGGGTAGGAGAGCCTGG + Intergenic
1075483388 10:122800386-122800408 AGCCTGGGGGCAGTAGAGCCTGG + Intergenic
1075483396 10:122800402-122800424 AGCCTGGGGGCAGGGGAGCCTGG + Intergenic
1075872909 10:125783574-125783596 GGGCTGTGGGCAGTCAAGCCAGG + Intergenic
1076119319 10:127922923-127922945 GGCCTGAGGGAGGCCGAGCTTGG - Intronic
1076296791 10:129391854-129391876 GGCCTGAGGTCAGGCCAGCCTGG + Intergenic
1077042740 11:531725-531747 GGCCTGAGGCCAGTCGGTGCTGG + Intergenic
1077289538 11:1782524-1782546 GGCCTGCGGCGAGTGGAGCCAGG + Intergenic
1077327849 11:1971405-1971427 GGGCTCAGGGCAGCCGAGCCAGG - Intronic
1084013112 11:66363600-66363622 GGGCAGAGGGCAGTGGAGCTGGG - Exonic
1084172387 11:67406759-67406781 GGACTGAGGGAGGTTGAGCCTGG + Intronic
1085664019 11:78396649-78396671 GACCTGAGAGCACTCCAGCCTGG - Intronic
1202810829 11_KI270721v1_random:26585-26607 GGGCTCAGGGCAGCCGAGCCAGG - Intergenic
1091563175 12:1629847-1629869 GGTCTGAGGGGAGTCGGGCGTGG + Intronic
1091633551 12:2180372-2180394 GGCCTGAGTGCTGGCAAGCCTGG + Intronic
1095211783 12:39502855-39502877 GGCCTGGGGGCAGTGAAGACAGG - Intergenic
1095960440 12:47831187-47831209 TGCCTGAGGTCAGACCAGCCTGG - Intronic
1096080994 12:48832400-48832422 GGTATGAGGGCAGCTGAGCCAGG - Exonic
1096370369 12:51064213-51064235 AGCCTGGGGGCAGCTGAGCCTGG + Exonic
1096513717 12:52145403-52145425 GGCCTGAGGGCAGGCGAGGGAGG + Intergenic
1096683356 12:53271637-53271659 GGCAAGAGGGCACTCCAGCCTGG + Intronic
1096839456 12:54371428-54371450 GGCCTGAGGACAGGAGAGTCTGG + Intronic
1100324427 12:93527671-93527693 GGCATGATGGCACTCCAGCCTGG + Intergenic
1102056490 12:109900371-109900393 TGCCTGCGGGAAGTCGGGCCGGG + Intronic
1102197205 12:111034091-111034113 GGGCTGGGGGGAGTCCAGCCCGG + Exonic
1104862163 12:131929457-131929479 GGTCTGGGGGCAGTAGAGACGGG + Exonic
1112972083 13:105273420-105273442 AGCCTGAGGGCAGCAGAGGCAGG + Intergenic
1113384198 13:109833259-109833281 GGCCCTAGGGCAGGAGAGCCCGG - Intergenic
1113420801 13:110170188-110170210 GGCCTGCGGTCAGTGGTGCCCGG + Intronic
1113663632 13:112125578-112125600 GCCGTGAGAGCAGTCGGGCCTGG - Intergenic
1117029331 14:51652272-51652294 GGCCCTAGGGCAGCCGAGCCCGG + Intronic
1122504959 14:102226562-102226584 GGGCTGAGGGCAGAGGGGCCAGG - Intronic
1123040699 14:105489110-105489132 GGCCTGGGGGCGGGCGAGGCTGG + Intronic
1123945616 15:25237486-25237508 GGCCTGTGGCCAGTGGTGCCAGG + Intergenic
1124215711 15:27805874-27805896 GGCCACAGGGCAGGGGAGCCTGG + Intronic
1127982676 15:64046229-64046251 GGCCTGACGGCAGCAGCGCCCGG - Intronic
1129591987 15:76924175-76924197 GGCTTGAGTGCAGTGGCGCCAGG + Intergenic
1132567805 16:631236-631258 GGCATGAGGGCCGCCGAGCCAGG - Exonic
1132677548 16:1126910-1126932 GGCCTGAGGCCAGTGCAGACGGG + Intergenic
1132734580 16:1379235-1379257 GGGCTGAGTGCAGGCGGGCCAGG + Intronic
1132810627 16:1795037-1795059 GGCCTGAGGCCAGCAGACCCGGG + Intergenic
1132903449 16:2270626-2270648 AGGCTGAGGGCAGTGGAGCTGGG + Intergenic
1133317728 16:4894656-4894678 GGCCTGAGGGCCTGGGAGCCCGG + Intronic
1134156992 16:11851898-11851920 GGCAGGTGGGCAGTGGAGCCAGG - Intergenic
1136030011 16:27495920-27495942 GGCAGGAGGGCAATCGAGCAGGG + Intronic
1136656316 16:31711396-31711418 GGCCTGAGGGCAGACAGGCCAGG - Intergenic
1137057812 16:35753837-35753859 AGCCTGAGGGCACCCCAGCCTGG + Intergenic
1137520942 16:49195080-49195102 GGCGAGAGGGCCGTCCAGCCAGG + Intergenic
1139506666 16:67401440-67401462 AGCCTGAGGTCAGACCAGCCAGG - Intronic
1139589693 16:67926749-67926771 CGGCTGAGGGCAGGCGATCCCGG - Intronic
1139775038 16:69311578-69311600 GGCCTGCGGGCCGCAGAGCCGGG + Intronic
1141159722 16:81621215-81621237 ACCCTGAGGGGAGTCCAGCCGGG + Intronic
1141428542 16:83958897-83958919 GGCCGGAAGGTAGACGAGCCGGG - Intronic
1141574596 16:84955777-84955799 GCCCTGAGGTCAGCCAAGCCAGG - Intergenic
1141913568 16:87077386-87077408 GGCCTGAGAGGATTCAAGCCAGG + Intergenic
1142904407 17:3032778-3032800 TGCCTGAGGGCAGGGGAGCAAGG - Intronic
1144775478 17:17782735-17782757 GGCCTGGGGCCCGGCGAGCCGGG + Intronic
1147673966 17:42192528-42192550 GGGCTGAGGGCACTGGAGGCTGG - Exonic
1149863527 17:60137863-60137885 GGCCTGGGAGCAGTAGAGCTTGG - Intergenic
1149994461 17:61399530-61399552 GGCCTGAGGCGAGGGGAGCCCGG - Intergenic
1150384956 17:64751408-64751430 GGCCTGAGGTCTGGCCAGCCAGG + Intergenic
1150822366 17:68445831-68445853 GGCCTGAGGGGAGCCAAGTCAGG - Intronic
1151570780 17:74924346-74924368 GGCCGGAGGGCAGTCGGACTTGG + Intronic
1152421112 17:80193692-80193714 GGCCAGGGGGCAGGTGAGCCTGG - Intronic
1152902143 17:82948440-82948462 GGCCTGTGGGCAGTGGTTCCCGG - Intronic
1153814295 18:8779552-8779574 GGCCTGAGGGAAGCTGAGCTCGG - Intronic
1154356818 18:13627843-13627865 GGCCAGAGGGCAGACGGTCCTGG + Intronic
1155213034 18:23619287-23619309 GGCCTGAGGGCGGTAGAGACGGG - Intronic
1160239786 18:77114890-77114912 GGCCTGGGGGCAGACGTGCCTGG + Intronic
1160809814 19:1008501-1008523 GGGCTTGGGGCAGTGGAGCCAGG - Intronic
1160820700 19:1056398-1056420 GGCCTGGGGGCAGGTGAGCACGG - Exonic
1160967644 19:1753644-1753666 GGCGGGAGGGCAGCCGAGCATGG + Exonic
1161279111 19:3435444-3435466 GGCCGGAGGGCAGGAGAGTCAGG - Intronic
1161742301 19:6029612-6029634 GGCCTGAGAACTGTTGAGCCTGG + Intronic
1162110723 19:8398254-8398276 GGCCTGAGCCCAGTCGACACGGG - Intronic
1162501881 19:11058728-11058750 GGCCTGCGGGCAGGCGAGGCGGG + Intronic
1163583682 19:18153121-18153143 TGCCCGAGCGCATTCGAGCCGGG - Intergenic
1164308919 19:24029622-24029644 GGCCTGAGGGCAGGAAGGCCAGG + Intergenic
1166098147 19:40554451-40554473 GGCCTGGGGGCGCTGGAGCCGGG + Intronic
1167378474 19:49125232-49125254 GGCCTGAGGGCCGTGGGCCCTGG - Intronic
1168315762 19:55484193-55484215 GGCCTGACGGCGGTGGGGCCAGG - Exonic
925405142 2:3601165-3601187 GGCGTGGTGGCAGTGGAGCCGGG + Intronic
926312060 2:11682051-11682073 GGCCTGAAGGCACTGGCGCCTGG + Intronic
926754150 2:16222287-16222309 AGCCTGTGGGCAGTTGAGACTGG + Intergenic
929597791 2:43187091-43187113 GTGCTGAGGGCAGGGGAGCCAGG - Intergenic
933944736 2:87276220-87276242 GGCCTCAGAACAGTCCAGCCAGG + Intergenic
934187953 2:89763236-89763258 GGCCTGAGGGCTGAGGACCCGGG + Intergenic
934729973 2:96650239-96650261 GCCCTGTGCGCAGTGGAGCCAGG - Intergenic
934766712 2:96883854-96883876 GGGCTGAGAGCAGCCCAGCCAGG - Intronic
935575194 2:104701863-104701885 GGCCAGAGAGCAGGCCAGCCTGG - Intergenic
936081428 2:109435175-109435197 GACCTGGGGGCAGCCGACCCGGG - Intronic
936335475 2:111585359-111585381 GGCCTGAGAACAGTCCAGCCAGG - Intergenic
936457622 2:112687380-112687402 GGCCTGGGGGCAGTGGAGAATGG - Intergenic
937370872 2:121296423-121296445 GGCCTGAGGGCAGCTCAGCAAGG - Intergenic
941029430 2:160493885-160493907 GGCCTGGGCGCCGCCGAGCCCGG + Intergenic
941230987 2:162912532-162912554 GGCTGGAGTGCAGTCGAGCAGGG - Intergenic
946249093 2:218402221-218402243 GGGCTGAGGGCTGTTGAGCAGGG - Intronic
947247590 2:228066610-228066632 TGCGTGGGGGCAGTGGAGCCAGG + Intronic
947716094 2:232339525-232339547 GGCCTGAGGACAGTGCAGCAAGG + Intronic
948116019 2:235494606-235494628 GGCCCGCGGGCCGCCGAGCCCGG - Exonic
948863477 2:240763971-240763993 GCCCTGAGGGGGGTCCAGCCGGG - Intronic
1170576695 20:17668498-17668520 GGCCTCAGGGAAGACCAGCCAGG + Intronic
1171986373 20:31664366-31664388 CCCCTGAGGGCAGCAGAGCCAGG + Intergenic
1172114834 20:32567450-32567472 GTGCTGAGGGCAGAGGAGCCAGG + Intronic
1172528593 20:35616140-35616162 AGCCCGAGGGCAGAAGAGCCCGG + Exonic
1172993479 20:39052632-39052654 GGCCAAACGGCAGCCGAGCCAGG - Intergenic
1173202820 20:40966652-40966674 GGCCTGAGCCCAGCCCAGCCTGG + Intergenic
1174039220 20:47687230-47687252 GGCCAGAAGGCAGCAGAGCCGGG + Intronic
1174053997 20:47785680-47785702 GGCCGGCGGGCAGGCGAGCGGGG - Intronic
1174444327 20:50580274-50580296 GGACTGAGGGCACTCAAGCCTGG - Intronic
1175193131 20:57224640-57224662 GGCCTGAGGCCAGGCCAGCTGGG - Intronic
1176896444 21:14383727-14383749 GGCCTGAGGGAAGTCGGCTCTGG + Intergenic
1177393745 21:20507877-20507899 AGCCTGAGGGCAGTGGTGGCAGG + Intergenic
1181694464 22:24585964-24585986 AGCCTGAGGGCAGTGCGGCCGGG - Exonic
1181854538 22:25772542-25772564 GGGCTGAGGGCAGGGGGGCCTGG + Intronic
1183427091 22:37745984-37746006 GGCCGGAGGGCGGGCGGGCCCGG - Intronic
1183707783 22:39485225-39485247 GGCAGGTGGGCAGGCGAGCCAGG - Intronic
1185105889 22:48869577-48869599 GGACACAGGGCAGTCAAGCCAGG - Intergenic
1185216207 22:49601271-49601293 GGTCTGGGGGCAGCAGAGCCGGG + Intronic
949281134 3:2348451-2348473 GGCCTGAGGGCTGGTGAGCCAGG - Intronic
950024220 3:9809790-9809812 GGCCCCGGGGCAGTCGAGCGAGG - Intronic
950421335 3:12901360-12901382 GGGCTGAGGGCAGGTGGGCCTGG + Intronic
950500715 3:13361870-13361892 GGCCTGGGGACAGCTGAGCCTGG - Intronic
951566890 3:24020055-24020077 GGGCTGAGGGCACTCGGCCCAGG - Intergenic
951674259 3:25218813-25218835 GGCCTCAGAGCTGTAGAGCCAGG + Intronic
953320154 3:41964084-41964106 GGGCAGAGGGGAGCCGAGCCAGG + Intergenic
953519447 3:43627382-43627404 GGTCTGAGGCCACTGGAGCCAGG + Intronic
953740723 3:45536547-45536569 GCCCTGAGGACAGGCCAGCCAGG - Intronic
954404652 3:50338670-50338692 GGTCTGAGGGGAGTAGAGACAGG - Intronic
959853475 3:111119357-111119379 AGCCTGGCGGCAGTCCAGCCTGG - Intronic
961328238 3:126124260-126124282 GGCGTGAGGGCAGAGTAGCCTGG - Intronic
961563309 3:127746389-127746411 CGCCTGGGGGCAGTTGAGGCAGG - Intronic
964416269 3:156451679-156451701 GGAGTGAGAGCAGTAGAGCCTGG - Intronic
966945280 3:184773441-184773463 GGGCCGAGGGCAGGCGGGCCGGG - Intergenic
967444873 3:189555003-189555025 GGGCTGAGGGCAGTTGGGCACGG - Intergenic
968184800 3:196625211-196625233 GGGATGTGGGCATTCGAGCCAGG + Intergenic
969349288 4:6588976-6588998 GGGCTGAGGGAAGTGGAGCTGGG + Intronic
969617464 4:8262053-8262075 GGCCTGCGGGCAGGGGTGCCGGG + Intergenic
969715721 4:8867352-8867374 GGCCTGAGGGCAGCTGCCCCGGG + Exonic
971819301 4:31530739-31530761 AGCCTGAGGGCAGTAGGGGCAGG + Intergenic
972319506 4:37960253-37960275 GGCCTGAGGTCAGACAAACCTGG - Intronic
976431148 4:84965727-84965749 GACCTGAGCGCAGCCGAGCGCGG - Intronic
980454076 4:133016405-133016427 TTCCTGAGGGCAGTTGAGCTTGG - Intergenic
983934798 4:173494182-173494204 GGCCGGTGGGCACTCGCGCCTGG - Intergenic
984644536 4:182205455-182205477 GGCCTCAGGGCCTTGGAGCCTGG + Intronic
984947277 4:184979658-184979680 GGCCTGAGTGCAGTGCAGTCAGG - Intergenic
985871366 5:2559997-2560019 GGCCTGAGGTCAGTGGAGGAGGG + Intergenic
993509488 5:88754103-88754125 AGCCAGAGGGCAGGAGAGCCTGG - Intronic
995788385 5:115856474-115856496 GGCATCAGGGCATTCCAGCCTGG - Intronic
996223328 5:120960305-120960327 GGCCTGAGGGCTGGCACGCCTGG - Intergenic
997976602 5:138444997-138445019 GGCCAGATAGCAGTAGAGCCTGG - Intronic
998094077 5:139387619-139387641 AGCCTCAGGGCACTCGGGCCTGG - Exonic
999399541 5:151253681-151253703 GACCTCAGGGCATTCGAGCAGGG - Intronic
1002099548 5:176850613-176850635 GGCCTCAGGAGAGCCGAGCCCGG + Intronic
1002160235 5:177310611-177310633 GGCCAGAGGGCAGTGGCCCCTGG + Intronic
1003324933 6:5084569-5084591 GGCCGGAGGCCATTCGCGCCAGG - Exonic
1006012332 6:31053631-31053653 GGGGTGAGGGCACTCGAGCAGGG + Intergenic
1006166794 6:32070082-32070104 GGCCTGAGGGGAGCAGAGCAGGG + Intronic
1007782792 6:44263948-44263970 GGCCTGAGGGCTGGTGATCCAGG + Intronic
1017693910 6:156994957-156994979 GGACTGAGGGCAGAAGAGTCAGG + Intronic
1018765544 6:166929992-166930014 CGCCTGTGGGCAGTGGAGCTGGG + Intronic
1018929158 6:168228908-168228930 GGCCTGAGGGCAGTGGACAGCGG + Intergenic
1019321685 7:418910-418932 GCCATGTGGGCAGTCCAGCCAGG + Intergenic
1023638939 7:42238461-42238483 GCCCCGAGGGCAGACGAGTCCGG - Intergenic
1023843278 7:44108250-44108272 AGCCTGAGGGCAGAGGAGACAGG - Intronic
1023994427 7:45150553-45150575 GACTTGAGGACAGTCCAGCCGGG + Intergenic
1025020044 7:55473467-55473489 GCCCTGAGGGCACACTAGCCCGG - Intronic
1025209913 7:57014439-57014461 GGCCTGAGGGGAGCAGGGCCAGG + Intergenic
1025662039 7:63562412-63562434 GGCCTGAGGGGAGCAGGGCCAGG - Intergenic
1027355810 7:77353991-77354013 GGCTTGAGGGCAGCAGAGCTGGG + Intronic
1029420477 7:100469433-100469455 GCCCTGGGGGCTGTTGAGCCAGG - Intronic
1029981383 7:104882625-104882647 GGCCTGAGGGGAGTGGAGAATGG + Intronic
1030684254 7:112468098-112468120 GTCCTGAGGGCAGTGGAGGTAGG + Exonic
1030756728 7:113294969-113294991 GGCCTGAGGGCAGGTCTGCCTGG + Intergenic
1032683532 7:134209246-134209268 GGGCTGAGGGGAGTGGGGCCAGG - Intronic
1035424289 7:158757431-158757453 GCCCTTAGGGCAGTGGAGCCAGG + Intronic
1035573389 8:688400-688422 GGCCGGAGGGAAGCGGAGCCTGG - Intronic
1036036682 8:5027841-5027863 GGTCTGGAGGCAGTGGAGCCAGG + Intergenic
1038032134 8:23651674-23651696 TGCCTGAGGTCAGACCAGCCTGG - Intergenic
1040851067 8:51900136-51900158 GGCATAGGGGCAGGCGAGCCGGG + Intergenic
1041707873 8:60865576-60865598 GGTTTGAGGGCAATCCAGCCGGG - Exonic
1044723211 8:95170178-95170200 GGACTGAGGGCAGACCAGGCAGG + Intergenic
1045000674 8:97875368-97875390 GATCTGAGGGCAATAGAGCCTGG + Intronic
1046983720 8:120364246-120364268 TGCCTGAGGGCAGTGGAGCCTGG - Intronic
1047747184 8:127853984-127854006 GGGCTGGGGGCAGAGGAGCCGGG - Intergenic
1049219476 8:141422396-141422418 GGCCTGAGGGCAGCTCAGCCGGG - Intronic
1049386331 8:142344805-142344827 GGCCTGAGGGCAGGAAACCCTGG - Intronic
1049579515 8:143404930-143404952 GGCCAGAGACCAGCCGAGCCAGG - Intergenic
1057604158 9:96486867-96486889 GGCCTCGGGGCAGTGGAGCAGGG - Intronic
1058908484 9:109499670-109499692 GTCCTGGGGGCAGTCGTTCCAGG + Intergenic
1059326986 9:113509849-113509871 GGCATTTGGGCAGTTGAGCCTGG + Intronic
1060114386 9:120928941-120928963 GGGCTGGGGGCAGTTGAGTCCGG + Intronic
1060485209 9:124042173-124042195 GGCCAGAAAGCAGTGGAGCCAGG + Intergenic
1061318221 9:129810945-129810967 GGGATCAGGGCAGTCCAGCCCGG - Exonic
1061520503 9:131114767-131114789 AGTCTGAGGGCAGTGGTGCCAGG - Intronic
1062294265 9:135815622-135815644 GACCTGGGGGCAGCAGAGCCCGG - Intronic
1187417212 X:19103756-19103778 GGCCTGGGGGCAGCACAGCCTGG + Intronic
1191958478 X:66672688-66672710 GGCCTGAGGGCAGACTAGACAGG + Intergenic
1197623820 X:128781127-128781149 AGCCTGAGGGCAGTAGGGGCGGG - Intergenic
1198208404 X:134492107-134492129 GGCTTGAGGCCAGACCAGCCTGG - Intronic
1200055272 X:153456877-153456899 GGCCTCAGAGCAGACGGGCCAGG - Intronic
1200163110 X:154019280-154019302 GGCCTCGGGGCAGTGGTGCCTGG + Exonic
1201269311 Y:12239121-12239143 GGCAGGAGGGCACTTGAGCCTGG + Intergenic
1201281981 Y:12350248-12350270 GGCCTGGGGGCAGTAGAAGCTGG - Intergenic