ID: 1067693548

View in Genome Browser
Species Human (GRCh38)
Location 10:48519738-48519760
Sequence CCATTTGATGGCATCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067693542_1067693548 -1 Left 1067693542 10:48519716-48519738 CCAGGCTCGACTGCCCTCAGGCC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG No data
1067693538_1067693548 7 Left 1067693538 10:48519708-48519730 CCACCTGCCCAGGCTCGACTGCC 0: 1
1: 0
2: 3
3: 43
4: 619
Right 1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG No data
1067693541_1067693548 0 Left 1067693541 10:48519715-48519737 CCCAGGCTCGACTGCCCTCAGGC 0: 1
1: 1
2: 2
3: 11
4: 203
Right 1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG No data
1067693539_1067693548 4 Left 1067693539 10:48519711-48519733 CCTGCCCAGGCTCGACTGCCCTC 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067693548 Original CRISPR CCATTTGATGGCATCTTGAG AGG Intronic
No off target data available for this crispr