ID: 1067693681

View in Genome Browser
Species Human (GRCh38)
Location 10:48520412-48520434
Sequence TCTGACGCTCTGAGCACCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067693681_1067693685 16 Left 1067693681 10:48520412-48520434 CCGCAGGTGCTCAGAGCGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1067693685 10:48520451-48520473 AGTGCAGATGATCTCCTTCAAGG No data
1067693681_1067693683 -10 Left 1067693681 10:48520412-48520434 CCGCAGGTGCTCAGAGCGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1067693683 10:48520425-48520447 GAGCGTCAGAACTGGTCATCTGG No data
1067693681_1067693687 30 Left 1067693681 10:48520412-48520434 CCGCAGGTGCTCAGAGCGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1067693687 10:48520465-48520487 CCTTCAAGGCAGAGCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067693681 Original CRISPR TCTGACGCTCTGAGCACCTG CGG (reversed) Intronic
900205917 1:1431872-1431894 TCAGACGGTGTGAGCAGCTGGGG + Intergenic
900517994 1:3092232-3092254 ACTGCCTCTCTGAGCCCCTGGGG - Intronic
900783575 1:4633580-4633602 TCTGCCGCACTGGGCACCCGGGG - Intergenic
903326800 1:22573518-22573540 CCAGATGCTCTGAGAACCTGTGG - Intronic
903945684 1:26960653-26960675 TGTCAGTCTCTGAGCACCTGTGG + Intergenic
904301411 1:29557044-29557066 TCTGCAGCTATGAGCCCCTGAGG - Intergenic
905775471 1:40665118-40665140 GCTGATGCTCAGAGCTCCTGGGG - Intronic
906537333 1:46558760-46558782 CCTGACGCTCTTCGCAGCTGAGG - Exonic
906864201 1:49398426-49398448 GCTGAAGGTCTGAGAACCTGTGG - Intronic
908010247 1:59769055-59769077 CATGAAGCCCTGAGCACCTGGGG + Intergenic
912968062 1:114254116-114254138 CCTGACTCTCTAAGCAGCTGTGG + Intergenic
915724250 1:158006684-158006706 TCAGCCGCTCAGAGCAGCTGGGG + Intronic
917728553 1:177851110-177851132 TCTGCCGCCCAGAGCACCTAAGG - Intergenic
920072011 1:203308738-203308760 CCTGGTGCTCAGAGCACCTGTGG + Exonic
921052515 1:211521140-211521162 TCTGAATCTGTGAGCACATGAGG + Intergenic
923857933 1:237864753-237864775 TCTGAGTCTCTGACAACCTGGGG + Intergenic
1065742916 10:28813229-28813251 TCTGACACTCTGAGTACTTGTGG + Intergenic
1067179443 10:43973740-43973762 TCAGCCACCCTGAGCACCTGGGG - Intergenic
1067450501 10:46379321-46379343 CCTGACGCTCTGAGCCCCATGGG + Intronic
1067586742 10:47480430-47480452 CCTGACGCTCTGAGCCCCATGGG - Intronic
1067693681 10:48520412-48520434 TCTGACGCTCTGAGCACCTGCGG - Intronic
1069835748 10:71307082-71307104 TGTGACCATCTGAGCACCTCTGG - Intergenic
1070549116 10:77476548-77476570 TCTGACCCGCTCAGGACCTGGGG - Intronic
1070781182 10:79138234-79138256 TCTGACCCTGTGGGCTCCTGGGG - Intronic
1072637665 10:97187969-97187991 TCTGTCACTCTGAGGACCTAGGG - Intronic
1073471986 10:103728120-103728142 CCTGAGGCTCTGAGGCCCTGAGG - Intronic
1075222616 10:120598356-120598378 GAGGATGCTCTGAGCACCTGGGG - Exonic
1076398206 10:130157219-130157241 TCTGAAGGCCTGAGAACCTGGGG + Intronic
1076419934 10:130324153-130324175 TCTGATACTCTGAGCTACTGGGG + Intergenic
1076519022 10:131068220-131068242 TCTGGGGCTGTGAGCCCCTGGGG - Intergenic
1077141360 11:1026286-1026308 TCAGACGCCCTGGGCTCCTGGGG - Intronic
1077240408 11:1507738-1507760 TCTGAGCCTGTGAGCTCCTGAGG - Intergenic
1081695312 11:45105496-45105518 TCAGAAGGCCTGAGCACCTGTGG - Intronic
1082562988 11:54641800-54641822 TCTGCCCCAGTGAGCACCTGTGG - Intergenic
1082959869 11:58908086-58908108 TCTGATCCTCTGTGCTCCTGTGG + Intronic
1084289559 11:68153074-68153096 TGTGAGGCCCTGAGCAGCTGGGG - Intergenic
1084950275 11:72661336-72661358 TCTGAGGCCCTGAGTAGCTGGGG + Intronic
1085046548 11:73356893-73356915 TCTGACTCTCTGGGAAGCTGGGG + Intronic
1087283272 11:96236031-96236053 TCTGTCGCTCTGGGACCCTGAGG + Intronic
1088917587 11:114239177-114239199 ATTGACACTCAGAGCACCTGTGG + Intronic
1091800586 12:3322104-3322126 CCTGACACTCTGGGCAGCTGCGG + Intergenic
1091820351 12:3471313-3471335 ACTTAGGCTCTAAGCACCTGGGG - Intronic
1095487159 12:42697168-42697190 TCAGACCCTCTGGGCACCCGTGG - Intergenic
1097822505 12:64142462-64142484 TCTGAGGCTCGGAGCTCCTGAGG - Exonic
1100286524 12:93172246-93172268 ACTGCCACTCTGAGAACCTGGGG - Intergenic
1100799095 12:98212696-98212718 TCTGATGCTCTTAGGAGCTGGGG + Intergenic
1105007612 12:132730953-132730975 TGTGACACTCGGAGCCCCTGGGG - Intronic
1107926906 13:45271782-45271804 TCTGACGGGCAGATCACCTGAGG - Intronic
1112149616 13:96743622-96743644 TCTGAAGCTCTGAGTCCTTGTGG + Intronic
1118356957 14:65022035-65022057 TCTGACTCTGTGAGCAGCAGAGG + Intronic
1119851631 14:77870654-77870676 ACTCACGCTCTGAGCTCCAGGGG - Intronic
1120634658 14:86936806-86936828 TCTGACATCCTGTGCACCTGAGG + Intergenic
1121416300 14:93781358-93781380 TCTGACCTTCTGAGACCCTGGGG + Intronic
1122501377 14:102202247-102202269 TCTGAGGCTCTGGCCTCCTGTGG + Intronic
1122773073 14:104105784-104105806 TCCCAGGCTCTGAGCACCAGGGG + Intronic
1123054974 14:105565035-105565057 TGTGACGCTGTGAGCCCTTGTGG + Intergenic
1123079416 14:105684614-105684636 TGTGACGCTGTGAGCCCTTGTGG + Intergenic
1125510188 15:40288601-40288623 TCTGAGGCTGTGGGAACCTGTGG - Exonic
1126906620 15:53374931-53374953 TCTGATGCTTTGAGAACCAGTGG - Intergenic
1131732150 15:95293541-95293563 TCTGTCCCTCTGTGGACCTGTGG - Intergenic
1133618689 16:7505065-7505087 TCTGACTCACTCAGCACCTCGGG - Intronic
1134874348 16:17683709-17683731 TCTGACGCACAGAGCCCCTCTGG + Intergenic
1137674931 16:50299483-50299505 CCTGTGGCTCTGAGCAGCTGGGG + Intronic
1138116896 16:54368121-54368143 CCTGAAGCTCTGAGCAATTGTGG + Intergenic
1139662813 16:68433328-68433350 TCAGACCCTCTGAACACATGAGG - Intronic
1139715337 16:68808930-68808952 TCAGAGGCTCTGAACACATGAGG + Intronic
1141659029 16:85431716-85431738 TCTGGCACTCTGAGCACCCAGGG + Intergenic
1141760068 16:86022472-86022494 TTTGGGGCTCTGAGTACCTGTGG + Intergenic
1141803251 16:86324902-86324924 TCTGGCTCTCTGGGCACCTGAGG + Intergenic
1141934201 16:87226350-87226372 CCTGAGGTTCTGAGCAACTGTGG + Intronic
1143639250 17:8186240-8186262 TCTGCCCCTCTGAACAGCTGCGG - Intergenic
1144498875 17:15768609-15768631 TGGGAGGATCTGAGCACCTGTGG - Intergenic
1148200363 17:45746290-45746312 TCTGAGGCTCAGGTCACCTGGGG - Intergenic
1148629429 17:49095418-49095440 TCTGAAGGACTGAGAACCTGGGG - Intergenic
1152595370 17:81235304-81235326 TCTGACGCTCTGCGCGCGTGGGG + Intronic
1153080913 18:1223971-1223993 TCTGAGGCTCTGGGCAAATGAGG + Intergenic
1153681741 18:7507584-7507606 TTTGCTGCTCTGGGCACCTGAGG + Intergenic
1155885559 18:31204070-31204092 TCTGATGCACTGAACACCTCTGG + Intergenic
1156447933 18:37250567-37250589 CCTGCCCTTCTGAGCACCTGGGG + Intronic
1160846636 19:1168901-1168923 TCTGCCGCTGTGGGCTCCTGGGG - Intronic
1163220482 19:15914745-15914767 CCTGAGGCTGTGAGCACCTTTGG + Exonic
1164460177 19:28440282-28440304 TCTGAAACTCTGATCACCTTAGG + Intergenic
1165960842 19:39532989-39533011 TCTGGTCCTCTGAGCGCCTGAGG + Intergenic
1166998157 19:46729633-46729655 TGTGCCCCTCAGAGCACCTGTGG - Intronic
925913514 2:8588200-8588222 TTTGACCTTCTGAGGACCTGTGG - Intergenic
929001956 2:37355863-37355885 TCAGATGCACTGTGCACCTGTGG - Intronic
929666282 2:43836576-43836598 GCTGACGTTCTCAGCAGCTGGGG - Intronic
929929140 2:46238632-46238654 ACTCCCGCTCTGAACACCTGTGG + Intergenic
930011179 2:46939950-46939972 GGTGCTGCTCTGAGCACCTGGGG - Intronic
931984452 2:67728037-67728059 TCTGTTGCTCTGAACACCTCAGG - Intergenic
933076072 2:77928054-77928076 TCTCAGGCTCTGAGTAACTGGGG + Intergenic
934662713 2:96151643-96151665 TCTGCTGCTCTGGGCACCTGAGG - Intergenic
935687953 2:105701108-105701130 TCTGACTATTTTAGCACCTGTGG - Intergenic
936045383 2:109183946-109183968 ACTGAGGCTCTGAGGAGCTGGGG - Intronic
937045497 2:118849086-118849108 ACTGAAGCTCTAGGCACCTGCGG + Intergenic
941129018 2:161624039-161624061 TGTTCCGCTCTGAGTACCTGGGG - Intronic
942729679 2:179050542-179050564 TCTGAGGCTCTGAGAAAATGTGG - Intergenic
944250425 2:197575486-197575508 TCAGACTCTCTGATCAACTGTGG + Intronic
944260897 2:197675825-197675847 TCTGTCGCTCAGGGCACCAGCGG + Exonic
1169010373 20:2245208-2245230 TCTGACACGCTGAGCAGCAGGGG - Intergenic
1169273524 20:4218119-4218141 GCTGGGGATCTGAGCACCTGAGG + Intergenic
1169557023 20:6762201-6762223 TCTTACTCTCTGAACATCTGTGG - Intergenic
1170851183 20:20005702-20005724 TCTGATGGTCTGGGCAGCTGGGG - Intergenic
1174580168 20:51565764-51565786 TCAGCAGCTCTGGGCACCTGTGG - Intergenic
1175169130 20:57067650-57067672 TCTGAAGGCCTGAGAACCTGGGG + Intergenic
1179809576 21:43861909-43861931 TCTGAGTGTCTGCGCACCTGCGG + Intergenic
1181711919 22:24696460-24696482 CCTGAGGGTCTGAGCACCTCTGG - Intergenic
1182048594 22:27296340-27296362 GCTGACGCTCTGAGGACCCGTGG - Intergenic
1182353121 22:29710045-29710067 TCTGACACTCTGAGGACCCGGGG - Intergenic
1183098673 22:35570146-35570168 TCTGAAACACTGAGCACCTAAGG + Intergenic
1183372047 22:37438394-37438416 TATGACGGTCTGAGCAGCTGCGG - Intergenic
1183544998 22:38450688-38450710 TCTAACTCTCTGGGCACCTTCGG + Intronic
1184961627 22:47933501-47933523 GCTGAAGGTCTGAGAACCTGGGG - Intergenic
1185148203 22:49150495-49150517 CCAGACGCTCTGAGCACCCCAGG - Intergenic
950780096 3:15384272-15384294 TTGGAAGCTCTGAGCACATGAGG - Intronic
953039922 3:39246678-39246700 GATGACACTCTGAGCAGCTGGGG + Intergenic
953260125 3:41330321-41330343 TCTGACAATCTGAGCACTTCTGG + Intronic
953836924 3:46354462-46354484 TCTGCCCCTCTGAGCACCCAAGG + Intronic
956911080 3:73817775-73817797 TCTGTGACTCTGAGCACCTTAGG + Intergenic
966154548 3:176901975-176901997 TCTGAAGCACAGAGCACTTGGGG + Intergenic
967420036 3:189262500-189262522 TCTGACTCTCTGAGCACAATGGG - Intronic
968930353 4:3575637-3575659 TGTGAAGCGCTGGGCACCTGTGG - Intergenic
969392834 4:6902323-6902345 CCTGAGGGTCAGAGCACCTGGGG + Intergenic
969671126 4:8590967-8590989 GCTGGGGCTATGAGCACCTGAGG - Intronic
975496007 4:75036736-75036758 TCTGGTGCTCTGAACGCCTGGGG - Intronic
979262864 4:118668230-118668252 TCTGAAGCCCTGAACTCCTGAGG + Intergenic
990449901 5:55924454-55924476 TCTGAAGCTCTGGGTCCCTGGGG - Intergenic
992481754 5:77158579-77158601 TCTGGAGCTCTGAGTGCCTGTGG + Intergenic
999396204 5:151230139-151230161 TCTGGCTCTCTGAGCACACGTGG + Intronic
1006513715 6:34534753-34534775 TCTGGGGCCCTGAGGACCTGGGG - Exonic
1007161229 6:39793037-39793059 TCTGGGGCTCTCAGCACCTGCGG + Exonic
1008511976 6:52284549-52284571 TCTAGCGCTCGGAGCCCCTGCGG - Intronic
1012229724 6:96746675-96746697 TCTGAAGGTCTGAGAACCAGAGG - Intergenic
1012597357 6:101055470-101055492 TGTCACACTCTGTGCACCTGTGG + Intergenic
1015189965 6:130461685-130461707 TCTGACCCTCTGACCAGCAGCGG + Intergenic
1015819849 6:137249189-137249211 TCTCAAGCACAGAGCACCTGAGG - Intergenic
1016455793 6:144229577-144229599 TCTGGCTGTCTGAGCTCCTGCGG + Intergenic
1017358442 6:153537549-153537571 TATGATGCTCTGTGCACCCGTGG - Intergenic
1018059116 6:160076708-160076730 TCTGAAGCTCTGAAAACTTGGGG + Intronic
1018291833 6:162299051-162299073 CCTGACCCTGTGAGCCCCTGTGG - Intronic
1018909448 6:168093691-168093713 TTAGACCCTCTGAGCAGCTGAGG + Intergenic
1019032846 6:169027530-169027552 TCACATGCTCTAAGCACCTGTGG - Intergenic
1020288177 7:6702049-6702071 TGTGACTCTCTGAGGCCCTGTGG - Intronic
1020415932 7:7945813-7945835 ACTGATTCTCTGAGGACCTGCGG + Intronic
1024159544 7:46660155-46660177 TCTGAAGGTCTGAGAACCAGGGG + Intergenic
1027426650 7:78068147-78068169 CCTGATGCTCTGAGGATCTGAGG - Intronic
1032853076 7:135811755-135811777 TCTGAAGATCTGAGAACCAGAGG + Intergenic
1033718309 7:144026430-144026452 TCTGAAGGCCTGAGAACCTGGGG - Intergenic
1034093509 7:148385533-148385555 CCTGAGGCTGTGAGCACCTGTGG + Intronic
1035930609 8:3776187-3776209 TCTGACCATCTCAGCACCGGAGG + Intronic
1040468601 8:47717522-47717544 TCTGCCTCTGTGTGCACCTGTGG - Intronic
1042067846 8:64898583-64898605 TCTGAAGTTCTGAGAACCAGGGG - Intergenic
1043278850 8:78437766-78437788 TCTGAAGGCCTGAGCACCAGGGG + Intergenic
1049173001 8:141173713-141173735 TCTGAGGATCTGAGGATCTGAGG + Intronic
1049310129 8:141929473-141929495 TCTGAGGCTCTGAGGAGCTCTGG - Intergenic
1049910339 9:259917-259939 TCTCTCACTCTGAGCACCAGTGG - Intronic
1051718929 9:20015211-20015233 TCTGATGCTCTGACCTGCTGAGG - Intergenic
1060512428 9:124243626-124243648 TCTCAGGCCCTGATCACCTGAGG + Intergenic
1186436920 X:9550988-9551010 TCTGGCGCTATGAACATCTGGGG - Intronic
1188526321 X:31091761-31091783 TCTGAATCTCTGACCACATGGGG + Intergenic
1189398155 X:40642062-40642084 TCTGCTGCTCTGAGCATCTGTGG - Intronic