ID: 1067693684

View in Genome Browser
Species Human (GRCh38)
Location 10:48520449-48520471
Sequence TTGAAGGAGATCATCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067693684_1067693691 -3 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693691 10:48520469-48520491 CAAGGCAGAGCCTGACAGGGGGG No data
1067693684_1067693697 15 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693697 10:48520487-48520509 GGGGGCCAGGATGAGTGGGGAGG No data
1067693684_1067693692 2 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693692 10:48520474-48520496 CAGAGCCTGACAGGGGGGCCAGG No data
1067693684_1067693687 -7 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693687 10:48520465-48520487 CCTTCAAGGCAGAGCCTGACAGG No data
1067693684_1067693689 -5 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693689 10:48520467-48520489 TTCAAGGCAGAGCCTGACAGGGG No data
1067693684_1067693694 10 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693694 10:48520482-48520504 GACAGGGGGGCCAGGATGAGTGG No data
1067693684_1067693690 -4 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693690 10:48520468-48520490 TCAAGGCAGAGCCTGACAGGGGG No data
1067693684_1067693700 25 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693700 10:48520497-48520519 ATGAGTGGGGAGGAGGACAAAGG No data
1067693684_1067693688 -6 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693688 10:48520466-48520488 CTTCAAGGCAGAGCCTGACAGGG No data
1067693684_1067693701 26 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693701 10:48520498-48520520 TGAGTGGGGAGGAGGACAAAGGG No data
1067693684_1067693695 11 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693695 10:48520483-48520505 ACAGGGGGGCCAGGATGAGTGGG No data
1067693684_1067693702 27 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693702 10:48520499-48520521 GAGTGGGGAGGAGGACAAAGGGG No data
1067693684_1067693696 12 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693696 10:48520484-48520506 CAGGGGGGCCAGGATGAGTGGGG No data
1067693684_1067693698 18 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693698 10:48520490-48520512 GGCCAGGATGAGTGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067693684 Original CRISPR TTGAAGGAGATCATCTGCAC TGG (reversed) Intronic
903240746 1:21981096-21981118 TTGATGGGGATCACCTGCTCGGG - Exonic
903244484 1:22005720-22005742 TTGATGGGGATCACCTGCTCGGG - Exonic
907220616 1:52904770-52904792 GCGAAGGAGCTCATCTTCACGGG - Exonic
908300431 1:62756813-62756835 TTGAATGAGATCATGGGGACTGG + Intergenic
909746399 1:79103322-79103344 GTGCAGGAGATCATTTTCACTGG + Intergenic
915831876 1:159139060-159139082 TTGAAGGATATCACCAGGACTGG - Intronic
916439895 1:164814005-164814027 TTGTTGGAAATAATCTGCACAGG + Intronic
923372677 1:233328404-233328426 CTGAAGGAGCTCATCGGCGCTGG + Exonic
924444078 1:244112411-244112433 TTGAAGCAAATCATCTGTAATGG + Intergenic
1067693684 10:48520449-48520471 TTGAAGGAGATCATCTGCACTGG - Intronic
1070517056 10:77218058-77218080 TTGAAGGAGATTATTTGCGTGGG + Intronic
1074585546 10:114764861-114764883 TTGTGGGAGGTCAGCTGCACTGG - Intergenic
1080122075 11:28689804-28689826 TTGAAGGAAATCATCTTCACTGG + Intergenic
1080952005 11:37044832-37044854 TGGAAGGAGATAAACTGCAGCGG + Intergenic
1081143033 11:39527253-39527275 TTCAAGGAGATCAACTTCTCTGG + Intergenic
1088934078 11:114380961-114380983 TTGAAGGAGTTTTTCTGCAGAGG + Intergenic
1091116242 11:133016276-133016298 GTGAAGCAGATCTTCTGCAGGGG - Intronic
1093774864 12:23061822-23061844 TTCAAGGATTTCATGTGCACTGG + Intergenic
1094104916 12:26801016-26801038 GTGAAGGAGCTCATCTTCACAGG + Intronic
1100354335 12:93814944-93814966 TTGAAAGAGATTCTCTGCAGAGG + Intronic
1106633561 13:31503526-31503548 TTGATGGAGATTATCTTAACTGG - Intergenic
1106898515 13:34330914-34330936 TTGAAGGAGCTCATCAGGAATGG - Intergenic
1107910517 13:45101224-45101246 GTGTTGGAGATAATCTGCACAGG + Intergenic
1108104247 13:46991434-46991456 TTGTAGGGGATCATCTACCCTGG + Intergenic
1114596464 14:23916573-23916595 TTGAAGCAGAGCAGCAGCACAGG + Intergenic
1115640542 14:35333006-35333028 TTGGAGGAGATACTCTGCAAGGG - Intergenic
1115962026 14:38845851-38845873 TTCAAGGAGATCCTCTTCATTGG - Intergenic
1118515402 14:66522616-66522638 TTTCAAGAGATCATCTGCAGGGG - Intronic
1118686378 14:68295523-68295545 TGGAACAAGGTCATCTGCACAGG - Intronic
1127057876 15:55150987-55151009 TTGAAGGAGAGCCTGTACACAGG + Intergenic
1131063598 15:89419085-89419107 TGGAGGGAGAAAATCTGCACTGG + Intergenic
1131672109 15:94631047-94631069 AAGAATGAGATCATCTGCAGTGG - Intergenic
1131808431 15:96147598-96147620 TTGAAGGAGGTCAGGTTCACTGG - Intergenic
1146620673 17:34394665-34394687 TTTCAGGAGTGCATCTGCACAGG - Intergenic
1148702334 17:49596354-49596376 TTGAAGGGGATCAACTCCAGGGG - Intergenic
1150002202 17:61448209-61448231 TTCAAGGATCTCATCTGCAGGGG + Intergenic
1153553305 18:6284842-6284864 TGGTAGGAGGGCATCTGCACAGG + Intronic
1159431279 18:68356683-68356705 TTGAAGGAAACCATTTGCATAGG + Intergenic
1162033628 19:7927715-7927737 TGGAAGGTGATGATCAGCACCGG + Exonic
925689881 2:6511012-6511034 TTGAAAGAGCTCTTCTCCACAGG + Intergenic
928915133 2:36462527-36462549 TTGAAGGACAACATCTGAAGAGG + Intronic
933717115 2:85369762-85369784 CTGAAGGAGATTAGCTGCCCAGG - Exonic
937006601 2:118521977-118521999 TTGATGGACATCTTCAGCACTGG - Intergenic
938076619 2:128341993-128342015 ACGAGGGAGCTCATCTGCACTGG + Intergenic
938652224 2:133395345-133395367 TTCAAGGAAATCTTCAGCACTGG - Intronic
938978048 2:136498155-136498177 TTGAAGGACTTCATCTTCATGGG + Intergenic
940527367 2:154833797-154833819 TTGAAAGAAATCATCTGAAAAGG - Intronic
948387890 2:237592954-237592976 ATGAAGGAGATCTTCTCCAGGGG - Intronic
948715317 2:239857264-239857286 TTCAAGGACATCATCTCCAAGGG + Intergenic
1168995782 20:2132157-2132179 TCGATGGAGATCATGAGCACTGG - Intronic
1175064521 20:56273711-56273733 TTGAAGGAGCTCACATGCATAGG + Intergenic
1178778311 21:35574114-35574136 TGGAAGGAGATAGTGTGCACTGG - Intronic
1179172875 21:38986310-38986332 TTCAAAGAGGTCATGTGCACAGG + Intergenic
1179543250 21:42098005-42098027 TTGCACGAGAACTTCTGCACTGG - Intronic
1182112180 22:27731610-27731632 TGGAAGGAGAGCATCTGCCCAGG - Intergenic
949147622 3:721752-721774 TTGAGAGAGATCATCTGAATGGG + Intergenic
956437834 3:69251615-69251637 TTGAAGCAGATCCTCTCCTCAGG - Intronic
956735901 3:72237968-72237990 TTGAAGGTGAGAAACTGCACTGG + Intergenic
959023841 3:101218303-101218325 TCGAAGAATATCATCTGCTCTGG + Intergenic
962521072 3:136197434-136197456 TTGCAGGAGATCAAGGGCACTGG + Intergenic
965954457 3:174351953-174351975 TTGAAGCAGTTCATCTGAAAAGG - Intergenic
967219002 3:187233739-187233761 TTGGACGAGATCATCAGCAGTGG - Intronic
969599194 4:8166033-8166055 TTGAGGCAGATCTTCTCCACTGG - Intergenic
969918977 4:10519205-10519227 TGTAAGTAGATCATCTGTACTGG - Intronic
970538734 4:17056204-17056226 TTGATTGAGATCGTCTTCACTGG - Intergenic
974551123 4:63375936-63375958 TTGATAGAGATAATCTGGACTGG + Intergenic
976922440 4:90456201-90456223 TTGAAGGAACCCATTTGCACAGG - Intronic
980314750 4:131183990-131184012 TTGAAAGATATAATCTGTACTGG + Intergenic
980338196 4:131502701-131502723 TGAAAGGAGATCAAGTGCACAGG + Intergenic
981324826 4:143433818-143433840 TTGAAAGAGACCATCTGTATAGG + Intronic
986887790 5:12261494-12261516 TTAAATGATATCATCTGCCCTGG - Intergenic
987195915 5:15526064-15526086 ATGAATGAGGTCATCTGCAATGG + Intronic
991664568 5:68985730-68985752 TAGAATGAGATCATCTGTGCAGG + Intergenic
996554767 5:124766985-124767007 GTGAATGAGATCATATGCATAGG - Intergenic
996877875 5:128259886-128259908 TAGAAAGAGATCAGCTGCAGGGG + Intronic
997142319 5:131395590-131395612 TTGCATTAGATCATGTGCACAGG + Intronic
1000555561 5:162721488-162721510 TTGAAGGAGATCAGGTGGAATGG - Intergenic
1002302432 5:178264941-178264963 TTGAATAAGATCATCTTCAGCGG - Intronic
1008648800 6:53543469-53543491 TGAAAGGAGATATTCTGCACTGG + Intronic
1010118345 6:72342081-72342103 TTGAAGGAAAGGATCTGCACAGG - Intronic
1012023642 6:93960135-93960157 TTGAAGGAGATAATCTTTATCGG + Intergenic
1014021642 6:116597422-116597444 TTAAAGGAGAACAGCTGCAAAGG - Exonic
1014656494 6:124112244-124112266 TTGAGGGAGATCATCAACACCGG - Intronic
1019219985 6:170465400-170465422 TTTAACGAGAGCAACTGCACTGG + Intergenic
1021063198 7:16139886-16139908 TTGCAGCAGATTATCTGCTCTGG - Intronic
1025854260 7:65264353-65264375 ATCATGGAGATCATCAGCACAGG + Intergenic
1028073866 7:86485972-86485994 TTGAATGAGGTAAGCTGCACAGG - Intergenic
1030173723 7:106630026-106630048 GTGAAGGAGGGCATCTGCAGGGG + Intergenic
1034689023 7:152999321-152999343 TTGAAGGAGATCAGGTGTTCTGG + Intergenic
1037548140 8:19943677-19943699 TTTAAGGAGATCTTGTGGACTGG - Intronic
1038713248 8:29968709-29968731 TTGAAGGAAATAATCTACATAGG - Intergenic
1039725241 8:40208452-40208474 ATGCAGGAGATCATACGCACTGG + Intergenic
1041399236 8:57424261-57424283 TTGAAGGAAAGCATTTTCACAGG - Intergenic
1042442085 8:68840416-68840438 TTTAGGGAGTTCATCTCCACAGG + Intergenic
1043834692 8:85033140-85033162 TTCATGGAGAACATCTGCTCCGG - Intergenic
1044770514 8:95626128-95626150 TAGAGAGAGATCATCTGCCCCGG - Intergenic
1047253929 8:123201523-123201545 TTTCAGGGGATCATCTTCACTGG + Intronic
1050624367 9:7487486-7487508 GTAAAGGAGATGATCTGCAGGGG + Intergenic
1050764923 9:9120620-9120642 ATGAAGCAGATCATCTGGAGAGG + Intronic
1186034844 X:5411295-5411317 TTGAATGAGATGATTTGCACAGG - Intergenic
1187665490 X:21604679-21604701 ATCAAGGAGATACTCTGCACAGG + Intronic
1188181326 X:27059548-27059570 TTGGAGAAGCTCATGTGCACGGG - Intergenic
1192485434 X:71520816-71520838 TTCAAGGAGACCAACTGCACAGG - Intronic
1192485509 X:71521649-71521671 TTCAAGGAGACCAACTGCACAGG - Intronic
1192485584 X:71522482-71522504 TTCAAGGAGACCAACTGCACAGG - Intronic
1199662486 X:150066002-150066024 TTGAATGAGATAATCTACAGGGG + Intergenic
1201572000 Y:15424712-15424734 TTGAGAGAAATCAGCTGCACTGG + Intergenic