ID: 1067693687

View in Genome Browser
Species Human (GRCh38)
Location 10:48520465-48520487
Sequence CCTTCAAGGCAGAGCCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067693684_1067693687 -7 Left 1067693684 10:48520449-48520471 CCAGTGCAGATGATCTCCTTCAA 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1067693687 10:48520465-48520487 CCTTCAAGGCAGAGCCTGACAGG No data
1067693681_1067693687 30 Left 1067693681 10:48520412-48520434 CCGCAGGTGCTCAGAGCGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1067693687 10:48520465-48520487 CCTTCAAGGCAGAGCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067693687 Original CRISPR CCTTCAAGGCAGAGCCTGAC AGG Intronic
No off target data available for this crispr