ID: 1067697451

View in Genome Browser
Species Human (GRCh38)
Location 10:48546179-48546201
Sequence ACACTGCCACAGGAGTAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067697451_1067697463 14 Left 1067697451 10:48546179-48546201 CCCCGCTACTCCTGTGGCAGTGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1067697463 10:48546216-48546238 ACATTGCCAGGGTAGGGGTGGGG No data
1067697451_1067697462 13 Left 1067697451 10:48546179-48546201 CCCCGCTACTCCTGTGGCAGTGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1067697462 10:48546215-48546237 GACATTGCCAGGGTAGGGGTGGG No data
1067697451_1067697460 9 Left 1067697451 10:48546179-48546201 CCCCGCTACTCCTGTGGCAGTGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1067697460 10:48546211-48546233 TGTCGACATTGCCAGGGTAGGGG No data
1067697451_1067697456 2 Left 1067697451 10:48546179-48546201 CCCCGCTACTCCTGTGGCAGTGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1067697456 10:48546204-48546226 TCTTTTCTGTCGACATTGCCAGG No data
1067697451_1067697461 12 Left 1067697451 10:48546179-48546201 CCCCGCTACTCCTGTGGCAGTGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1067697461 10:48546214-48546236 CGACATTGCCAGGGTAGGGGTGG No data
1067697451_1067697457 3 Left 1067697451 10:48546179-48546201 CCCCGCTACTCCTGTGGCAGTGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1067697457 10:48546205-48546227 CTTTTCTGTCGACATTGCCAGGG No data
1067697451_1067697464 15 Left 1067697451 10:48546179-48546201 CCCCGCTACTCCTGTGGCAGTGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1067697464 10:48546217-48546239 CATTGCCAGGGTAGGGGTGGGGG No data
1067697451_1067697459 8 Left 1067697451 10:48546179-48546201 CCCCGCTACTCCTGTGGCAGTGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1067697459 10:48546210-48546232 CTGTCGACATTGCCAGGGTAGGG No data
1067697451_1067697458 7 Left 1067697451 10:48546179-48546201 CCCCGCTACTCCTGTGGCAGTGT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1067697458 10:48546209-48546231 TCTGTCGACATTGCCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067697451 Original CRISPR ACACTGCCACAGGAGTAGCG GGG (reversed) Intronic
903047992 1:20578779-20578801 GCACTGCAACATGGGTAGCGAGG - Intergenic
904395121 1:30215058-30215080 ACACAGCCACAGCAGCAACGAGG + Intergenic
911167406 1:94736161-94736183 ACACAGCCACAGGAGAATGGGGG - Intergenic
911309352 1:96274591-96274613 TCACTGCCACAGGAACAGTGTGG - Intergenic
915462742 1:156079973-156079995 ACACTGCAGCAGGAGGAGGGAGG + Intronic
916694708 1:167222241-167222263 ACACCGCCACAGAAGAAGGGAGG - Intronic
918185247 1:182121103-182121125 CCACTGCCACAGAAGTCCCGTGG + Intergenic
918663878 1:187123792-187123814 ACACTGCCACAAAATTAACGAGG + Intergenic
919177996 1:194044196-194044218 ACCCAGCAACAGGAGCAGCGAGG - Intergenic
920571579 1:207022034-207022056 ACACTGACACAGGGGGGGCGAGG + Exonic
923235716 1:232031099-232031121 ACACTGCCAAAGAAGGAGGGAGG + Intronic
924494478 1:244573652-244573674 AGACTGCCACAGAAGAAGCCAGG - Intronic
924558031 1:245133919-245133941 AGAGTGACACAGGAGAAGCGTGG + Intergenic
1065369497 10:24969248-24969270 TCACAGCCAAAGGAGTAGCATGG - Intergenic
1066114010 10:32223732-32223754 ACTCAGCCTCAGGAGTAGCTGGG - Intergenic
1067697451 10:48546179-48546201 ACACTGCCACAGGAGTAGCGGGG - Intronic
1076060560 10:127410983-127411005 GAACTGCCACTGGAGAAGCGTGG + Intronic
1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG + Intronic
1079637632 11:22764442-22764464 ACTCAGCCTCCGGAGTAGCGGGG - Intronic
1081194203 11:40141375-40141397 TCAGTGCCACAGGAGTAGTGGGG - Intronic
1081337652 11:41886701-41886723 ACACTGCCACAGCATGAGCATGG + Intergenic
1081859343 11:46323591-46323613 TCCCTGCCTCAGGAGTAGCTGGG - Intergenic
1083455260 11:62774491-62774513 CCCCTGCCAGAGGAGTAGTGGGG + Intronic
1085224762 11:74909662-74909684 AAACTGCCACAGGAGGGGCTCGG - Intronic
1089083694 11:115798968-115798990 ACATTACCACAGGAGCAGGGAGG - Intergenic
1090986015 11:131766828-131766850 TCACTGCCACGTGAGTAACGGGG + Intronic
1091786246 12:3244864-3244886 CCACTGCCCCAGGAGGAGCAGGG - Intronic
1093755750 12:22850395-22850417 ACACTGCCACAGGGGCTGCATGG - Intergenic
1098333332 12:69376248-69376270 CCTCTGCCACACGAGTAGCTGGG - Intronic
1100124600 12:91408275-91408297 ACACTGTCACAGGAGTGCAGTGG + Intergenic
1103327199 12:120129600-120129622 ACCCTCCCACAGGAGCAGGGGGG - Intronic
1108211983 13:48148503-48148525 ACACTGCCACACCAGCAACGTGG + Intergenic
1110623576 13:77626240-77626262 TCACTACCACAGGAATAGTGAGG + Intronic
1111661663 13:91220174-91220196 GCACTGCCACATGAGTGGCATGG + Intergenic
1117589412 14:57251196-57251218 ACTCTGCCACAGGGCTAGGGTGG - Intronic
1118335036 14:64846222-64846244 ACTCTGCCCCAGAAGTAGAGTGG + Intronic
1118874349 14:69770674-69770696 ACACTGCCAAAGGTGTGGGGGGG - Intronic
1123944106 15:25230689-25230711 ACACTGGCCCAGGAAAAGCGAGG - Intergenic
1129584896 15:76852249-76852271 ACACTGCCAGTGGAGTACTGAGG - Intronic
1131214918 15:90529260-90529282 AAGCTGCCACAGGAGTGGAGAGG + Intergenic
1133217007 16:4298752-4298774 ATCCTGCCTCAGGAGTAGCTGGG + Intergenic
1133871313 16:9689089-9689111 CCTCAGCCACAGGAGTAGCTGGG + Intergenic
1142316211 16:89347182-89347204 ACACTGCCACAGCAGCACCTGGG + Intronic
1145370227 17:22301282-22301304 GCACAGCCTCAGGAGTTGCGTGG + Intergenic
1146445542 17:32929807-32929829 ACACTTTCACAGGAGTGGTGAGG - Intronic
1147574860 17:41593284-41593306 AGACTGCCCCAGAAGTAGTGGGG + Intergenic
1155348814 18:24885858-24885880 ACACTGCAACAGGGATAGCAAGG + Intergenic
1160435210 18:78846485-78846507 ACAGTGCCACAGGACTGGGGAGG - Intergenic
1165131535 19:33635387-33635409 TCACTGCCACAAGAGGAGGGAGG + Intronic
1166133000 19:40757824-40757846 CCTCAGCCACAGGAGTAGCTGGG - Intronic
929101213 2:38316048-38316070 ACACTGCCACAGGAGAAAAGTGG + Intronic
929952388 2:46423706-46423728 ACTCTGCCTCCGGAGTAGCTGGG - Intergenic
934947060 2:98549883-98549905 CCACTTCCACAGAAGTAGCATGG - Intronic
934966177 2:98724957-98724979 CCTCAGCCACAGGAGTAGCTGGG - Intronic
935167312 2:100580727-100580749 CCATTGCCACTGGAGTAGAGGGG - Intergenic
939350966 2:141036941-141036963 TCACTGCCACAGGAGGAGAAGGG + Intronic
939793036 2:146604419-146604441 ACAATGTCTCAGGAGTACCGTGG + Intergenic
941405651 2:165084299-165084321 ACACTGCCACAACAGTACTGGGG + Intergenic
942677096 2:178438792-178438814 ACTCAGCCTCCGGAGTAGCGGGG + Intronic
943665400 2:190603551-190603573 ACACTGCCCCAGGAGTAGGATGG - Intergenic
946071484 2:217037795-217037817 ACACTGGCAGAGGAGTTGCTAGG - Intergenic
947833463 2:233158608-233158630 TCACTGTCTCAGGAGTAGGGAGG + Intronic
947834873 2:233167887-233167909 TCTCTGCCTCAGGAGTAGCTGGG - Intronic
1173126445 20:40340420-40340442 AGATTGCCACAGGACTAGCTGGG - Intergenic
1173398386 20:42702157-42702179 ACACTCCCACAGGAGGTGGGAGG - Intronic
1175884533 20:62281709-62281731 ACTCTGTAACAGGAGAAGCGCGG - Intronic
1176262916 20:64192432-64192454 ACACAGCCACAGCAGCATCGGGG + Intronic
1179279987 21:39925793-39925815 ACAAGGCCACAGGAGCAGGGTGG - Intronic
1182686135 22:32122694-32122716 ACACTGAGGCAGAAGTAGCGGGG + Intergenic
1184723341 22:46328828-46328850 GTACTGCCACAGAAGTAGCTCGG + Exonic
950148835 3:10670531-10670553 CCTCTGCCTCAGGAGTAGCTGGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
952769136 3:36981767-36981789 ACTCAGCCTCAGGAGTAGCTGGG + Intergenic
963337235 3:143989213-143989235 ACAATGCTACAGGAATAGTGGGG - Intronic
967725577 3:192859396-192859418 ACAGTGCCAGATGAGGAGCGGGG + Intronic
968290011 3:197531929-197531951 ACACTGCCACAGGTGGAGACTGG - Intronic
969430154 4:7149210-7149232 ACTCAGCCTCAGGAGTAGCTGGG - Intergenic
973763658 4:54144011-54144033 ACTCTGCCTCCGGAGTAGCTGGG - Intronic
979059946 4:116044643-116044665 ACAGTGCCCCAGGGGTAGGGAGG + Intergenic
982467093 4:155744825-155744847 ACAGTTCCACAGGACTAGGGAGG - Intergenic
982617219 4:157653818-157653840 ACACTGGCACATGACTAACGGGG + Intergenic
983825017 4:172248870-172248892 ACAGTTCCACAGGGGTAGGGAGG - Intronic
988715920 5:33828134-33828156 GCACTGCCAGGGGAGTAGCCTGG - Intronic
998265484 5:140664835-140664857 ACACTGCGGGAGGAGTAGCCTGG - Exonic
999035814 5:148348184-148348206 ACACTGTCTCAGGAGTGGAGTGG + Intergenic
1003254662 6:4464421-4464443 ACACTGCCACAGGAGTTCCCAGG + Intergenic
1003790032 6:9535979-9536001 CCTCTGCCTCAGGAGTAGCTGGG + Intergenic
1007393773 6:41565641-41565663 CCATCGCCACAGGAGTAGCTGGG - Intronic
1007766714 6:44165002-44165024 CCTCAGCCACAGGAGTAGCTGGG + Intronic
1007882791 6:45185975-45185997 CCACTGCTACAGGAGTAGGAGGG - Intronic
1014625131 6:123715656-123715678 ACACTGCTAAAGGAGTTGCCTGG + Intergenic
1018962213 6:168457099-168457121 ACACTGCCTCAGGCACAGCGCGG + Intronic
1019657216 7:2202279-2202301 ACTCAGCCACAGGAGGAGCTGGG + Intronic
1022706906 7:32810381-32810403 ACACAGCCTCCCGAGTAGCGAGG - Intergenic
1026167898 7:67927362-67927384 ACACTTTCACAGGTGCAGCGGGG + Intergenic
1029676615 7:102074259-102074281 ACACTGTCACAGGAAAAGGGAGG + Intronic
1031991229 7:128200592-128200614 AGACTGACACAGGAGGAGCCGGG + Intergenic
1034620112 7:152450381-152450403 CCTCTGCCTCAGGAGTAGCTGGG + Intergenic
1034622851 7:152469672-152469694 TCACTACCACAAGAGTAGCACGG - Intergenic
1035563331 8:625060-625082 TCACTGCCACAAGAACAGCGAGG + Intronic
1035617443 8:1012692-1012714 ACACTGCCGCTGAAGTAGGGGGG - Intergenic
1051387702 9:16527385-16527407 ACAGTGCCACAGGGGTAGACAGG - Intronic
1052169313 9:25374410-25374432 TCACTACCACAGGAATAGCATGG + Intergenic
1052644724 9:31218973-31218995 TCTCGGCCACAGGAGTAGCTGGG - Intergenic
1054950921 9:70850645-70850667 ACACTGCTACTTGAGTAGTGTGG + Intronic
1060811632 9:126613963-126613985 ACCATGGCACTGGAGTAGCGCGG + Intergenic
1061604271 9:131697035-131697057 ACACTGATACATAAGTAGCGGGG + Intronic
1188757034 X:33975004-33975026 ACACTGGCAAAGCAGTAGGGTGG + Intergenic
1189413294 X:40792493-40792515 TCACTGCCACAGGAGTAGAAAGG + Intergenic
1189876980 X:45446742-45446764 ACACTGCCTTAGGAATAGAGTGG - Intergenic
1190684807 X:52862266-52862288 ACATAGCCTCAGGAGTAGCTGGG + Intergenic
1193614692 X:83672442-83672464 TCACTACCACAAGAGTAGCATGG - Intergenic
1196397452 X:115280298-115280320 AAAGTGCAACAGGAGTAGAGAGG + Intergenic
1199713750 X:150491345-150491367 ACAGTGCCACAGGATTAACCTGG + Intronic
1200696807 Y:6368246-6368268 ACACAGCCTCAGGAGCAGCTGGG - Intergenic
1200919174 Y:8597809-8597831 ACACTGCCTCAGGAGCTGCCAGG + Intergenic
1201037306 Y:9796453-9796475 ACACAGCCTCAGGAGCAGCTGGG + Intergenic