ID: 1067700020

View in Genome Browser
Species Human (GRCh38)
Location 10:48564679-48564701
Sequence GGGCTGCAGAAACACTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067700020_1067700023 2 Left 1067700020 10:48564679-48564701 CCTGCACAGTGTTTCTGCAGCCC 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1067700023 10:48564704-48564726 AATGCCCATCCATCATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067700020 Original CRISPR GGGCTGCAGAAACACTGTGC AGG (reversed) Intronic
901463717 1:9407127-9407149 GGTCTGCACCAACACTGGGCTGG - Intergenic
902474304 1:16673123-16673145 GGGCTGCAGAGCCTCTGTACTGG + Exonic
902484499 1:16734319-16734341 GGGCTGCAGAGCCTCTGTACTGG - Exonic
904796741 1:33062059-33062081 GTGGTGCAAAAACACTGGGCAGG - Intronic
904915064 1:33964177-33964199 GCGCTGCAGCAAGACTGTCCGGG + Intronic
906089137 1:43163134-43163156 GGGCTGCAGAAACAGAATGAAGG + Intergenic
906794326 1:48684951-48684973 GGCCTGAGAAAACACTGTGCAGG + Intronic
910536938 1:88309336-88309358 GGACTGCAGAAGATCTGTGCAGG + Intergenic
910914276 1:92272643-92272665 GGGATGCAGGAACGCTGGGCAGG + Intronic
912014575 1:105017161-105017183 CGGTAGAAGAAACACTGTGCTGG + Intergenic
912655595 1:111483808-111483830 TTGCTGCAGAAACACTCTTCAGG - Intronic
912688987 1:111789497-111789519 GGGTTGCAGAACCACTGCCCTGG + Intronic
912959203 1:114180501-114180523 GGGCTACAGAAACAATCTGATGG + Intergenic
913662035 1:121012829-121012851 GGGCTGCAGAGCCTCTGTACTGG + Intergenic
914013409 1:143796014-143796036 GGGCTGCAGAGCCTCTGTACTGG + Intergenic
914164416 1:145165171-145165193 GGGCTGCAGAGCCTCTGTACTGG - Intergenic
914652033 1:149704623-149704645 GGGCTGCAGAGCCTCTGTACTGG + Exonic
914838880 1:151231286-151231308 GGGCTCCAGATACACTCTGGGGG + Intronic
916484177 1:165243433-165243455 AGGCAGCAATAACACTGTGCTGG + Intronic
916959528 1:169874972-169874994 AGGCTGCAGAAAGATTGTGAAGG + Intronic
1062848449 10:725730-725752 GGGCTCCAGACACACCCTGCTGG - Intergenic
1065558700 10:26941392-26941414 GCTCTGCAGAAACCTTGTGCCGG + Intergenic
1067332213 10:45333136-45333158 AGTCTGCTCAAACACTGTGCTGG + Intergenic
1067700020 10:48564679-48564701 GGGCTGCAGAAACACTGTGCAGG - Intronic
1069695783 10:70384354-70384376 TGGGTACAGAAACACTGTACTGG - Intergenic
1070538135 10:77394494-77394516 GGGCTGCCGAAGCAGTGGGCAGG + Intronic
1071406426 10:85338036-85338058 GAGGTGCAGAATCACTGTGAAGG + Intergenic
1072553247 10:96494779-96494801 TGCCTCCAGAAACACTGAGCTGG - Intronic
1075664444 10:124220712-124220734 GGGCTGCAGAAGCTGGGTGCAGG - Intergenic
1076504084 10:130960500-130960522 GGGCTGCACCAACTGTGTGCGGG + Intergenic
1076717125 10:132371834-132371856 GGGCTGCAGAGCCAGTGTGCAGG + Intronic
1076886374 10:133264625-133264647 AGGCTGCAGCAGAACTGTGCAGG - Intronic
1077899961 11:6480107-6480129 GGGCTGCAGAAGCATTTTGGAGG + Intronic
1078233181 11:9460969-9460991 GGGCCTCAGACACACTATGCGGG + Exonic
1078301908 11:10140082-10140104 GGGTTTTAGAAGCACTGTGCCGG - Intronic
1080174347 11:29343794-29343816 GGGCAGCAGAAATCCTGTGTAGG + Intergenic
1081609593 11:44552745-44552767 GGGCTCCAGAAACAGCCTGCAGG + Intergenic
1081655281 11:44853210-44853232 GGGCAGCAGAGAGACTGTGGAGG + Intronic
1081744123 11:45461141-45461163 GGTCTGCAGAACCTCTGAGCTGG - Intergenic
1081928859 11:46853846-46853868 TGGCTGCTGAATAACTGTGCTGG + Intergenic
1081960558 11:47133519-47133541 GGGCTGGGGGACCACTGTGCTGG - Intronic
1082881368 11:58041324-58041346 GGTCTGCACATCCACTGTGCTGG - Intronic
1083159731 11:60847757-60847779 GGGCTGCAGAAACTTGGGGCGGG - Intronic
1083734097 11:64669858-64669880 GGCCTGCAGAAGCACAGTGTTGG - Intronic
1085309784 11:75509328-75509350 GGGCTGCAGACACACAGTTCTGG + Intronic
1085645107 11:78217796-78217818 GAGCTGAGGAAACACTGGGCCGG + Exonic
1086569638 11:88266942-88266964 TGGGTCCAGAAACACTGTCCAGG - Intergenic
1087281586 11:96216795-96216817 GGGCTGGAGCAACACGGTGCAGG + Intronic
1088147236 11:106695987-106696009 GGGTTGCAGAAAAAATGTGCAGG - Intronic
1089105161 11:115996896-115996918 AGGCAGAAGAAACGCTGTGCTGG + Intergenic
1089178267 11:116563718-116563740 GGGCTGCACAAACACTGAGCGGG - Intergenic
1089281968 11:117381052-117381074 GGGCTGAAGAAACCTTGTGGAGG + Intronic
1089680008 11:120114099-120114121 GGGCTGCAGAGAAGCTGAGCTGG - Intronic
1090743421 11:129687632-129687654 GGGGTGCAGAATGAGTGTGCTGG + Intergenic
1091280577 11:134379639-134379661 GGGCTGCTGGGACACTGAGCAGG - Intronic
1091285150 11:134404740-134404762 GAGCCGCAGAGACACAGTGCTGG + Intronic
1091790407 12:3268912-3268934 AGGCTGCAGGAACACAGGGCAGG - Intronic
1091790470 12:3269242-3269264 AGGCTGCAGGAACACAGGGCAGG - Intronic
1091790474 12:3269262-3269284 AGGCTGCAGGAACACAGGGCAGG - Intronic
1097908781 12:64947424-64947446 GGGCTGCAAAATCACTCTCCAGG - Intergenic
1102966376 12:117130846-117130868 GGGCTGGAGATACTGTGTGCTGG - Intergenic
1106502344 13:30340945-30340967 AGGCTGCAGAAAGTCTATGCTGG + Intergenic
1107770720 13:43786217-43786239 GGGCAGCGGGAACACTGTGTGGG + Intronic
1108004832 13:45935811-45935833 GGGCTGCAGACTCACTTTCCAGG - Intergenic
1119630473 14:76227516-76227538 GGTGTGCAGCAACACTGTGTAGG + Intronic
1119873968 14:78041037-78041059 GGTCTCCATCAACACTGTGCAGG + Intergenic
1120015376 14:79467318-79467340 GGGCTTCAGCACCACTGTGAAGG + Exonic
1120525628 14:85573769-85573791 TGGCTGCAAAAATACTGTCCTGG - Intronic
1120699342 14:87681279-87681301 GGGCTGCAGACAAACTGCACGGG - Intergenic
1121931628 14:97977697-97977719 GGGTTTGAGAAACCCTGTGCTGG + Intronic
1123114040 14:105885847-105885869 GGGCAGCAGAAACAATGGACAGG - Intergenic
1125956761 15:43795711-43795733 GGGCAGCAGAAACACAGTGAGGG + Exonic
1128325183 15:66719536-66719558 GGGCTGCAGACACCCTGTTTGGG - Intronic
1129793514 15:78358691-78358713 TGGCTTCAGAAACAATGTGTAGG + Intergenic
1130126131 15:81095579-81095601 GGGCACCAGAACCACTGTGCAGG - Intronic
1130573184 15:85067183-85067205 TGGATGCAGAGGCACTGTGCAGG + Exonic
1131132309 15:89908178-89908200 GGGCTGAAGAGACACTTTCCAGG + Intronic
1131552083 15:93365747-93365769 GAGCTGCAGGGGCACTGTGCAGG + Intergenic
1132031137 15:98439203-98439225 GGGCTGTAGAAACCCATTGCAGG - Exonic
1132339100 15:101066811-101066833 GGGCAGCAAAGCCACTGTGCAGG - Intronic
1132346945 15:101114234-101114256 GAGCTGCAGAAACACATCGCTGG + Intergenic
1132734237 16:1377689-1377711 GGGCTGCAGAGCCACTGTGTTGG - Intronic
1138052501 16:53794784-53794806 CAGCTGCAGAAACACTATGGAGG + Intronic
1138650411 16:58457364-58457386 GGGCTGCAGGAGCACTATGATGG + Intergenic
1139427833 16:66894232-66894254 GGGCTGCAGGGCCACTGTGGAGG + Intronic
1139755168 16:69136718-69136740 GGGCTACAGAAGCTTTGTGCTGG + Exonic
1141544528 16:84756039-84756061 GGGCTGCAGAAACTCTGGGAAGG - Intronic
1142441898 16:90103832-90103854 GGACTCCTCAAACACTGTGCAGG - Intergenic
1142856763 17:2735015-2735037 AGGCTGCAGAAACGCTGCTCAGG - Intergenic
1143382385 17:6504429-6504451 GGGCTACAGAAACAGGGTGATGG - Intronic
1143678858 17:8460743-8460765 GGAATGCAGAAACAGTGTGAAGG - Intronic
1144139995 17:12339093-12339115 GGGCTGCAAAGACACTGACCAGG - Intergenic
1144733457 17:17541750-17541772 TGGCTGCAGACACCCTGGGCAGG - Intronic
1145244986 17:21262806-21262828 GGGCTGCAGGAGCCCTGTGAAGG - Intergenic
1146175119 17:30661161-30661183 GGGCTGTACAAGCACAGTGCTGG + Intergenic
1146348572 17:32077195-32077217 GGGCTGTACAAGCACAGTGCTGG + Intergenic
1151161287 17:72167870-72167892 GGGAGGCAGATACCCTGTGCTGG - Intergenic
1152180197 17:78814994-78815016 GGTGTGCAGCAACGCTGTGCAGG + Intronic
1152647368 17:81475681-81475703 GGGCCCCACAAACACTGTGGTGG + Intergenic
1152704538 17:81835987-81836009 GGAATGCAGAGACACTATGCAGG - Intergenic
1152881936 17:82822561-82822583 GGGCTTCAGGAACACAGTGAGGG + Intronic
1156556690 18:38076437-38076459 GGGCTGCAGGAAGAGTGTGGAGG + Intergenic
1157545170 18:48541247-48541269 GGGCCGCAGAGACACAGCGCCGG - Intronic
1157845315 18:50998946-50998968 GGGCTGGTGGAACACTGTGAGGG - Intronic
1158917291 18:62146617-62146639 GGGCTGCTGAAATTCTGTCCCGG - Intronic
1159062846 18:63533998-63534020 GGGATGCACAAACACTGCTCTGG + Intergenic
1160925124 19:1540675-1540697 GGGCTGCAGGCACGCTGGGCTGG + Intergenic
1163263016 19:16202623-16202645 GCGCATCAGAATCACTGTGCTGG - Intronic
1164580198 19:29430036-29430058 GGGATACAGAAACACTGAGCCGG - Intergenic
1165668535 19:37655255-37655277 GGGCTGCAGAAGCTCAGTCCCGG + Exonic
1166740081 19:45109335-45109357 GGGATGGAGAAACACAGGGCTGG + Intronic
1166778526 19:45327120-45327142 GGGCTGAAGGAACACTGCTCGGG + Intergenic
1166979638 19:46624958-46624980 GGGATGCAGCAACACAGAGCAGG - Intronic
1202707681 1_KI270713v1_random:35527-35549 GGGCTGCAGAGCCTCTGTACTGG + Intergenic
926624488 2:15079710-15079732 GGGCTGCAGAAACCCAGGGGAGG - Intergenic
927645422 2:24874151-24874173 AGGCTGCAGGAACATTCTGCCGG - Intronic
927938925 2:27091630-27091652 GGGCTCCAGTAACACTGTGAGGG + Intronic
929532554 2:42761978-42762000 GGGCTGGAGATACACGGTGGAGG + Intergenic
929977977 2:46653524-46653546 CTGCTGCAGAAAGACTGGGCAGG + Intergenic
931191162 2:60001725-60001747 GGGCTGGGGAAGCCCTGTGCAGG - Intergenic
934502202 2:94870233-94870255 GGGCTGGAGAGACCCTGGGCGGG + Intergenic
935129292 2:100249379-100249401 AGCCTGGAGAAACCCTGTGCGGG - Intergenic
939997638 2:148934952-148934974 GGCCTGCCGAAACAATCTGCAGG - Intronic
941371670 2:164672952-164672974 GGGCTGCAGTTACACAATGCAGG - Intronic
941952276 2:171168082-171168104 ATGCTGCAGAAACAATGTCCAGG - Intronic
943575507 2:189626765-189626787 GGGAAGGAGAAACACAGTGCAGG - Intergenic
944535356 2:200704344-200704366 GAACTGCACACACACTGTGCAGG + Intergenic
944738323 2:202588661-202588683 TGGTTGTAGTAACACTGTGCTGG + Intergenic
947889758 2:233606635-233606657 AGGCTGCACAAGCACGGTGCTGG + Intergenic
948656445 2:239479527-239479549 GGGCTGTAGGAACACTGAGTAGG + Intergenic
948665336 2:239531173-239531195 AGGCTGCAGAAAGGCAGTGCAGG + Intergenic
1171250503 20:23642567-23642589 AGGCTGCAGAAACACTAAGAGGG - Intergenic
1171935579 20:31272261-31272283 GGGCTGCAGCATCATAGTGCTGG + Intergenic
1173125848 20:40335348-40335370 GGACTGCAGAGACACTGTTAAGG + Intergenic
1173538479 20:43833484-43833506 GGGCTGGAGAAAGACCGTCCTGG - Intergenic
1175526879 20:59640484-59640506 GGGGTGCAGAGACACTGGGGAGG + Intronic
1175607015 20:60319384-60319406 GAGCTGAGGAAACAGTGTGCAGG - Intergenic
1175731568 20:61357759-61357781 GGGTTGTAAAAACACAGTGCCGG + Intronic
1176371375 21:6063823-6063845 GGTTTGCAGAAAAACTGAGCAGG + Intergenic
1178654843 21:34452789-34452811 GGGCTGTTGAATCACTGAGCAGG + Intergenic
1179752144 21:43474716-43474738 GGTTTGCAGAAAAACTGAGCAGG - Intergenic
1179784874 21:43723876-43723898 GTGCTGCAGGACCACAGTGCAGG + Intronic
1180114562 21:45691795-45691817 AGACTGCAGAAACACTCTGCTGG - Intronic
1180712049 22:17846107-17846129 AGCCTGCAGAAATGCTGTGCTGG + Intronic
1184345519 22:43910319-43910341 GGGCTGCAGAAGCAGAGGGCAGG - Intergenic
1184799743 22:46752238-46752260 GGGCTCCCAGAACACTGTGCAGG + Intergenic
1184846338 22:47090132-47090154 GAGCTGGAGAACCACTTTGCTGG - Intronic
950135429 3:10577493-10577515 GGGCTGCAGAAACCATCGGCTGG + Intronic
953638893 3:44686940-44686962 GGGCAGGAGAAAATCTGTGCAGG + Intergenic
959567230 3:107844873-107844895 AGGCCACAGAAACACTGAGCAGG + Intergenic
967148437 3:186626476-186626498 GGGTGGCAGAAACGCTGTGGAGG - Intergenic
967280882 3:187822506-187822528 GGGCTGCAGAAAAACTCTTTGGG + Intergenic
968064491 3:195751099-195751121 GTGCTGCAGAATCGCTGTGTGGG + Exonic
968362166 3:198154799-198154821 GGACTCCTCAAACACTGTGCAGG - Intergenic
968429356 4:546276-546298 GGGCACCACAACCACTGTGCTGG - Intergenic
970175595 4:13336400-13336422 AGGCAGCACAAACGCTGTGCCGG - Intergenic
975326987 4:73069638-73069660 GTGGTGCAGAAATGCTGTGCCGG - Exonic
980875602 4:138659201-138659223 CAGATGCAGAAACACTGTCCTGG + Intergenic
981941507 4:150286485-150286507 GGGCTGCAGAATTACTGTGGGGG - Intronic
983046245 4:162989921-162989943 GCTCTGCAAAAACCCTGTGCGGG - Intergenic
985160563 4:187040126-187040148 GAGCTTAAGAAGCACTGTGCTGG - Intergenic
985552129 5:539125-539147 GAGCTGCAGACACACAGAGCTGG - Intergenic
985676550 5:1234446-1234468 GGGCTGCAGATAGCCTGTACTGG - Intronic
985960767 5:3301624-3301646 GTGCTGCAGAAACTGTGTGGTGG + Intergenic
986410983 5:7479258-7479280 GTGTCGCAGAAACACTGTACTGG + Intronic
986520658 5:8614215-8614237 GGGCTGCAGAGAGATTGTGGAGG + Intergenic
986573666 5:9190990-9191012 GGGCTACAAAAATACTGTGCTGG + Intronic
987828989 5:23071781-23071803 GGGGTGCAGGACCACTGTCCTGG + Intergenic
991561375 5:67957363-67957385 GGACTGAAAACACACTGTGCTGG - Intergenic
994428224 5:99622245-99622267 GGGTTGCAGAGTCACAGTGCTGG + Intergenic
994671364 5:102765498-102765520 GTGCTGCAGGAACTCTGTGAGGG + Intronic
996540557 5:124626753-124626775 GGGCTGCTGAACCCATGTGCTGG - Intergenic
999126879 5:149252426-149252448 GGGCTTCAGAGACACTCTGTTGG + Intronic
999288839 5:150410189-150410211 GGGTTGCAGAAGCACTGAACAGG - Intronic
1001639387 5:173234270-173234292 GGGCTGCAGAAAGAAGGTCCAGG + Intronic
1002304777 5:178276679-178276701 GGGCTGCAGCAAGACTGTCCGGG + Intronic
1003097664 6:3155427-3155449 GGGCTGCAGCAGCCCTCTGCAGG + Intronic
1003101348 6:3178734-3178756 GGGCTGCAGCAGCCCTCTGCAGG + Intergenic
1004491776 6:16124490-16124512 CTGCTGCAGAAACCCTATGCTGG - Intergenic
1004809623 6:19245950-19245972 TGTCTGCAGAAACACCTTGCAGG + Intergenic
1006184261 6:32171408-32171430 GGGCTGCAGAACCACAGGGTGGG + Exonic
1007429241 6:41767206-41767228 GGGCTGCAGGGAGACTGTGTTGG - Intergenic
1009975101 6:70663801-70663823 GGGCTTCAGCATCTCTGTGCAGG - Intergenic
1014090531 6:117399251-117399273 GTGCTACAGAAATACCGTGCAGG - Intronic
1015175016 6:130296797-130296819 GGCCTGCAGCCACACTGTGGTGG + Intronic
1018603806 6:165576777-165576799 AGGAGGCAGAAACACTGTGAAGG - Intronic
1019253514 7:33908-33930 GGACTCCTCAAACACTGTGCAGG + Intergenic
1020106658 7:5425242-5425264 GGGCTGCAGAGAGAGGGTGCGGG - Intronic
1024717522 7:52096806-52096828 GGGCTGTAAAAAAACTTTGCAGG + Intergenic
1025990504 7:66493411-66493433 GACCCACAGAAACACTGTGCTGG + Intergenic
1026960584 7:74405048-74405070 GGGCTGGAGACGCTCTGTGCAGG - Exonic
1027213166 7:76166424-76166446 GACCCACAGAAACACTGTGCTGG + Intergenic
1029209595 7:98895895-98895917 GGGTTGCAGAAATAGTGTGTGGG + Intronic
1031235412 7:119169148-119169170 GGGCTACAGTAGCACAGTGCTGG - Intergenic
1032496396 7:132366103-132366125 GAGCTCCAAAAACATTGTGCAGG + Intronic
1032718212 7:134528880-134528902 GGGCTGCAGAGAGCCTGGGCTGG + Intronic
1032964655 7:137081912-137081934 GTGCTGGAGAGACACAGTGCTGG + Intergenic
1034422880 7:150998544-150998566 GCGCTGCGGGAACACTGTGATGG - Exonic
1035596253 8:860396-860418 GGGCTCCAGAAACACTTTCAAGG + Intergenic
1035602878 8:907508-907530 GGGCTGTTGGAACATTGTGCTGG - Intergenic
1035606290 8:931720-931742 GGGCTGCTGAAACACAGTGGTGG + Intergenic
1035690246 8:1555207-1555229 GGGCTGCGGAAGGATTGTGCAGG - Intronic
1036533110 8:9615573-9615595 GTGCTGCAGCAGCACTGTGCAGG - Exonic
1036620678 8:10423000-10423022 TGTCACCAGAAACACTGTGCTGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039060277 8:33567024-33567046 GGGCTGCAGAAGCCCTCGGCCGG + Exonic
1041121838 8:54593795-54593817 GGGCTGAAGCAAGACTGGGCTGG + Intergenic
1042803360 8:72745042-72745064 GAGCTGCAGTAGCAGTGTGCTGG - Intronic
1045051982 8:98335776-98335798 GGGCTGCAGACCCATTGTGAAGG - Intergenic
1045823663 8:106371799-106371821 GGCCTGAAGAAACACTCTGGTGG + Intronic
1045955453 8:107900542-107900564 GGGCTGCAGTGAAACTGAGCAGG + Exonic
1045983637 8:108221652-108221674 GGGCTTGAGAAACACTGTCCAGG + Intronic
1046568346 8:115930344-115930366 GAGCTGCAGAAGCACTGTGTTGG - Intergenic
1049012499 8:139896787-139896809 GGGCTGGAAAAACACTGGCCAGG - Intronic
1050909698 9:11053513-11053535 GAGCAGCAGAAACACGGAGCGGG + Intergenic
1055165302 9:73184821-73184843 GGGCTGCAGCAGCACAATGCTGG + Intergenic
1056615277 9:88160217-88160239 GGGCTGGGGAAATTCTGTGCAGG - Intergenic
1057188371 9:93071933-93071955 GGGCTCCCGAAACAGTGTGCTGG + Intronic
1057220107 9:93252987-93253009 GGGCTGCACACACACTGGGCCGG - Exonic
1057998203 9:99839898-99839920 GGGCAGCAGAGACACAGAGCTGG + Intronic
1058917952 9:109585849-109585871 CGGCTGCAGACACACTGGGGAGG - Intergenic
1059356388 9:113702548-113702570 AGGCTTGAGAACCACTGTGCTGG - Intergenic
1060767558 9:126306539-126306561 GGGCTGTGCAAACACTTTGCAGG - Intergenic
1061159374 9:128884367-128884389 GGCATGGAGAGACACTGTGCTGG - Intronic
1061777174 9:132973289-132973311 GGGCTGGGGAAGCTCTGTGCGGG - Intronic
1062294177 9:135814897-135814919 GGGCTGCAGTGAGCCTGTGCTGG - Intronic
1062746853 9:138218461-138218483 GGACTCCTCAAACACTGTGCAGG - Intergenic
1189256559 X:39644516-39644538 GGGGTGCAGGAGCACTGTGGGGG + Intergenic
1195331077 X:103801189-103801211 GGGGTGCTGGAACACTGTGGAGG - Intergenic
1197627016 X:128813531-128813553 GAACAGAAGAAACACTGTGCTGG - Intergenic
1198338853 X:135693905-135693927 GGGCAGCAGCAGCATTGTGCGGG - Intergenic