ID: 1067701476

View in Genome Browser
Species Human (GRCh38)
Location 10:48576152-48576174
Sequence TATGGGCTCCCCACTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067701472_1067701476 -8 Left 1067701472 10:48576137-48576159 CCCTACGTCAGAGACTATGGGCT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG No data
1067701467_1067701476 18 Left 1067701467 10:48576111-48576133 CCTGCCTGTAGGATGAGCATCCT 0: 1
1: 1
2: 1
3: 6
4: 113
Right 1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG No data
1067701469_1067701476 -2 Left 1067701469 10:48576131-48576153 CCTATGCCCTACGTCAGAGACTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG No data
1067701468_1067701476 14 Left 1067701468 10:48576115-48576137 CCTGTAGGATGAGCATCCTATGC 0: 1
1: 0
2: 0
3: 14
4: 71
Right 1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG No data
1067701473_1067701476 -9 Left 1067701473 10:48576138-48576160 CCTACGTCAGAGACTATGGGCTC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067701476 Original CRISPR TATGGGCTCCCCACTGGGTG TGG Intronic
No off target data available for this crispr