ID: 1067702408

View in Genome Browser
Species Human (GRCh38)
Location 10:48583339-48583361
Sequence TGCAGTGATCCCCCTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067702398_1067702408 24 Left 1067702398 10:48583292-48583314 CCCCTTGGCATTGAAGGGGCATG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1067702408 10:48583339-48583361 TGCAGTGATCCCCCTGGGGTAGG 0: 1
1: 0
2: 0
3: 30
4: 180
1067702399_1067702408 23 Left 1067702399 10:48583293-48583315 CCCTTGGCATTGAAGGGGCATGG 0: 1
1: 0
2: 2
3: 9
4: 106
Right 1067702408 10:48583339-48583361 TGCAGTGATCCCCCTGGGGTAGG 0: 1
1: 0
2: 0
3: 30
4: 180
1067702401_1067702408 22 Left 1067702401 10:48583294-48583316 CCTTGGCATTGAAGGGGCATGGG 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1067702408 10:48583339-48583361 TGCAGTGATCCCCCTGGGGTAGG 0: 1
1: 0
2: 0
3: 30
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067702408 Original CRISPR TGCAGTGATCCCCCTGGGGT AGG Intronic
901404504 1:9037428-9037450 TGCACAGTTCCCACTGGGGTGGG + Exonic
902715390 1:18269237-18269259 TGGGGTGATCCACCTGGGGCAGG + Intronic
903741294 1:25560141-25560163 TGAAATGGTTCCCCTGGGGTGGG + Intronic
904051963 1:27645301-27645323 TGTTGTGAGCCCCCTGGGGTGGG - Intergenic
905474704 1:38217822-38217844 GGCAGTGATCTCACTGGGGAGGG + Intergenic
908451800 1:64263330-64263352 TGCAGTGTGCCCCCAGGGTTTGG + Intronic
911527755 1:99005719-99005741 TGCAGGGATTCCTCAGGGGTCGG + Intergenic
915125697 1:153662354-153662376 TCCAGTCTTCCCCCTTGGGTAGG + Exonic
915214363 1:154329982-154330004 TGCAGTGGTCCCCAGGGGGAAGG + Intronic
915737565 1:158094594-158094616 GGCAGTGTTCCCTCTTGGGTGGG - Intronic
917854124 1:179087806-179087828 TGCAATGGACCCCCTGGGGCTGG - Intronic
920562439 1:206948317-206948339 TACACTGAGCTCCCTGGGGTGGG + Intergenic
1065246060 10:23758919-23758941 TCAGGTGATCCACCTGGGGTGGG + Intronic
1066357900 10:34702491-34702513 TGCAGTGAGCCGCCAGGGGCTGG - Intronic
1066489025 10:35876107-35876129 TGCAGAGAGCCTCCTGGGGATGG - Intergenic
1067526669 10:47043428-47043450 TGCAGTGCTTCCCATGGGGGAGG + Intergenic
1067702408 10:48583339-48583361 TGCAGTGATCCCCCTGGGGTAGG + Intronic
1067778542 10:49180067-49180089 TCCACTGATACCCCTGGGGGCGG - Intronic
1070091173 10:73286971-73286993 AGCAGTTTTCCCCCTTGGGTGGG + Intronic
1070589656 10:77792763-77792785 TGCAGTTAACACCCTGGGTTGGG + Intronic
1070684565 10:78471383-78471405 ATCAGTGAGCCCCCTGGGGGAGG + Intergenic
1075737397 10:124672411-124672433 TGCCGAAATCCTCCTGGGGTTGG + Intronic
1076333267 10:129687386-129687408 TCCAGTGATACCCTTGGCGTCGG - Intronic
1076501956 10:130944185-130944207 TGCTGTGAGCCACGTGGGGTGGG + Intergenic
1076961315 10:133764183-133764205 TGCACTGATCACCCAGGGGATGG - Intergenic
1077671976 11:4165777-4165799 GGCAGAGCTGCCCCTGGGGTGGG - Intergenic
1080600786 11:33819189-33819211 TGCAGTGATCCACCTTGGGCAGG - Intergenic
1080645488 11:34184795-34184817 TGCAGTGAGCCCCATGGGTGGGG - Intronic
1081767668 11:45622676-45622698 TGCAGAGCTCCCCTTGGGGCTGG + Intergenic
1082203096 11:49397628-49397650 TGCAGAGCTCCCCATAGGGTGGG + Intergenic
1083339899 11:61952197-61952219 TCCAGGGGTCCTCCTGGGGTTGG - Intronic
1083651199 11:64205895-64205917 TCCAGTGAACACACTGGGGTTGG - Intergenic
1086651943 11:89302451-89302473 TGCAGAGCTCCCCATAGGGTAGG - Intergenic
1087786583 11:102361503-102361525 TGCTGTGAACCCCCTGGAGAGGG - Intronic
1091284202 11:134399050-134399072 TGCAGTGAGCCCCCCCGGGGAGG - Intronic
1091644258 12:2261960-2261982 TGCAGTTATCCTCATGGGGGAGG + Intronic
1091847567 12:3669188-3669210 TGAACTGGTGCCCCTGGGGTGGG + Intronic
1092720210 12:11433581-11433603 TTCAGGGATCCCCCAGGGTTAGG - Intronic
1093963234 12:25298661-25298683 TGCAGTGAGTCCGGTGGGGTGGG - Intergenic
1095763014 12:45861804-45861826 TCCAGTGATCCCTCTGGCCTCGG + Intronic
1100137063 12:91566760-91566782 CACAGTGATCACGCTGGGGTAGG + Intergenic
1101967836 12:109293110-109293132 TGCAGTGAGCCTCCAGGGGTGGG - Intronic
1103757935 12:123224574-123224596 TGCAGTGATCTCAATGGGGAAGG + Intronic
1104517697 12:129443075-129443097 TCCAGAGCTCCCCTTGGGGTCGG + Intronic
1105437260 13:20390047-20390069 TTCAGTGAGCCCCCTGGAGTGGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1107555897 13:41516457-41516479 CGCAGGGGTCCCCCAGGGGTGGG + Intergenic
1111485613 13:88895464-88895486 TGCAGAGATACCCCTGTGGCTGG - Intergenic
1113602838 13:111582870-111582892 TGCTGTGCTTTCCCTGGGGTGGG + Intergenic
1113956668 13:114103059-114103081 TGCATTTCTCCCCCTGGGGCCGG - Intronic
1115711293 14:36054152-36054174 TCCAGTCTTCCCCCTTGGGTAGG + Intergenic
1119502518 14:75142381-75142403 TGCTGTGATCACCCTGGGTAGGG - Intronic
1121300874 14:92869734-92869756 TGCAGTGATTTCCCTTGAGTGGG - Intergenic
1122643748 14:103177688-103177710 TCCAGGGACCCCCCTGGGGTGGG - Intergenic
1202848894 14_GL000225v1_random:3340-3362 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202848937 14_GL000225v1_random:3748-3770 TGCACTGATCCCCCAGGTGATGG - Intergenic
1202850118 14_GL000225v1_random:11134-11156 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202850622 14_GL000225v1_random:15778-15800 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202853004 14_GL000225v1_random:32807-32829 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202853291 14_GL000225v1_random:35328-35350 TGCACTGATCACCCAGGTGTTGG - Intergenic
1202854090 14_GL000225v1_random:39108-39130 TGCAATGATCACCCTGGTGAGGG - Intergenic
1202857770 14_GL000225v1_random:62170-62192 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202859078 14_GL000225v1_random:70459-70481 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202861312 14_GL000225v1_random:83793-83815 TGCACTGATCACCCTGGTGATGG + Intergenic
1202863367 14_GL000225v1_random:99307-99329 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202864488 14_GL000225v1_random:106268-106290 TGCACTGATCACCCTGGGGATGG - Intergenic
1202866231 14_GL000225v1_random:119894-119916 TGCACTGATCATCCTGGGGAGGG + Intergenic
1202866517 14_GL000225v1_random:122697-122719 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202866969 14_GL000225v1_random:127028-127050 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202867789 14_GL000225v1_random:134305-134327 TGCACTGATCACCCTGTGGAGGG + Intergenic
1124783601 15:32658820-32658842 TCCAGAGATCCCCGTGGTGTTGG - Intronic
1127149764 15:56061199-56061221 TGCAGTGAACCCTCTGGCCTGGG + Intergenic
1127862303 15:63004401-63004423 TGAAGAGATTCCCCAGGGGTGGG - Intergenic
1128736722 15:70057786-70057808 GGCAGGGATCCCACTTGGGTGGG - Intronic
1131805310 15:96115791-96115813 TGCAAACATCTCCCTGGGGTTGG + Intergenic
1132114561 15:99126069-99126091 TGAAGTGAGGCCCCTGGGGGTGG + Intronic
1132405277 15:101538286-101538308 TGGCTTGATCCTCCTGGGGTTGG - Intergenic
1133258660 16:4534410-4534432 TGCAGTGATCACAATGGGGCTGG + Intronic
1133312770 16:4860995-4861017 GGAAGTGATTCCCTTGGGGTGGG + Exonic
1136122117 16:28144461-28144483 TGCAGTGATCACGCTGTGGCTGG - Intronic
1137589960 16:49687373-49687395 TGCAGTGCTAGCCCAGGGGTAGG - Intronic
1138721793 16:59090841-59090863 TGCAGAGATCCCCCTAGAGTTGG + Intergenic
1140421279 16:74821346-74821368 TCCAGTGGTCCCTGTGGGGTTGG + Intergenic
1141519885 16:84571649-84571671 TCCAATCATCCCCCTGGGATCGG + Intronic
1146061829 17:29611904-29611926 TGCAGTGATGGCAGTGGGGTTGG - Exonic
1146454219 17:32996773-32996795 TGCAGTGAGCACCCTGGTCTGGG + Intronic
1148837215 17:50471706-50471728 GGCAGCGATCCCCCAGGGGCGGG - Intronic
1151170473 17:72241540-72241562 TGCAGTGGTGCCCTTGGGTTTGG - Intergenic
1152325038 17:79631131-79631153 TGCAGTCAACCCTCTGGGGTGGG + Intergenic
1152419935 17:80187148-80187170 AGCAGCGTTCCCCCTGGGGAAGG - Intronic
1152965025 18:106714-106736 TGCACTGATCACCCTGGTGATGG + Intergenic
1152965046 18:106850-106872 TGCACTGATCACCCAGGGGATGG + Intergenic
1152965493 18:110737-110759 TGCACTGATCACCCTGGGGAGGG + Intergenic
1152965504 18:110805-110827 TGCACTGATCACCCTGGGGAGGG + Intergenic
1154396340 18:13993458-13993480 TAGAGTGATACCCCTTGGGTGGG + Intergenic
1157816930 18:50736345-50736367 TGCTGAGATCCCCCTGGTCTAGG - Intergenic
1158951443 18:62499157-62499179 GGCAGTGATCCCGTTGGGGAAGG - Intergenic
1160761086 19:784846-784868 GGCAGTGCTGCCCCTGGCGTTGG - Intergenic
1161405702 19:4090124-4090146 TGCAGTGAGCCCCCAGGCGATGG - Intergenic
1162263742 19:9552955-9552977 AGCAGTGATCACACTGAGGTAGG + Intergenic
1164781479 19:30896912-30896934 TCCAGGGATATCCCTGGGGTCGG - Intergenic
1166134776 19:40769456-40769478 TCCAGTGAACCCCCTGGGTCAGG - Intergenic
1167213316 19:48147588-48147610 TGCAGTGGTGCTCCTGGGCTCGG - Intronic
1167492803 19:49801886-49801908 TGTGGTGAGTCCCCTGGGGTGGG + Exonic
925277134 2:2658004-2658026 TGGGGAGAACCCCCTGGGGTAGG + Intergenic
925889514 2:8422162-8422184 TGCTGTGTTCCCCTTGGGGCAGG - Intergenic
927526314 2:23744573-23744595 TGCAGTAACCACCATGGGGTTGG + Intergenic
933284079 2:80365882-80365904 TGCATTTTTCCCCCTGTGGTCGG + Intronic
936046364 2:109191188-109191210 TGCAGTGATGCCACTGGGATGGG + Intronic
936154098 2:110037126-110037148 TGCCCTGAGCCCACTGGGGTAGG - Intergenic
936190586 2:110334289-110334311 TGCCCTGAGCCCACTGGGGTAGG + Intergenic
936515235 2:113177145-113177167 GGCAGTGCTCCCCCAGAGGTAGG - Intronic
937639484 2:124195356-124195378 TGCAGTGAACCCCCTTGCGCAGG + Intronic
937910422 2:127073035-127073057 AGCAGGGGTCCCCATGGGGTGGG + Intronic
938403595 2:131014716-131014738 AGCAGTGGTCTCCCTGAGGTGGG + Intronic
938663105 2:133507161-133507183 GGCAGTGATCCAGCTTGGGTTGG - Intronic
945191050 2:207187842-207187864 TGCAGTGAGCCCCTTGTGCTTGG + Intergenic
946814852 2:223566274-223566296 TGCAGTGATACCACAGTGGTGGG - Intergenic
947126417 2:226873579-226873601 TGCAGTGATGACTCTGGGGAAGG + Intronic
948154133 2:235767676-235767698 TGCTGTGTTCCCTGTGGGGTTGG + Intronic
948484391 2:238271271-238271293 TGCCTTGTTCCCTCTGGGGTCGG - Intronic
948633565 2:239318283-239318305 TCCAGTGATGCCGCTGGGCTTGG - Intronic
1168840004 20:903818-903840 AGCAGGGATGCCCCAGGGGTAGG + Intronic
1171481687 20:25459748-25459770 GGCAGAGATCCCCCTTGGGCTGG - Intronic
1172620190 20:36313529-36313551 TGCAGTGACAGCTCTGGGGTGGG + Intronic
1172836428 20:37876278-37876300 TGCAGTGATCATCCTTGTGTAGG + Intergenic
1175586869 20:60148087-60148109 TGCAGTGCTTTCCATGGGGTGGG - Intergenic
1176429412 21:6566872-6566894 TGAAGTGATGTCACTGGGGTGGG + Intergenic
1179704806 21:43174334-43174356 TGAAGTGATGTCACTGGGGTGGG + Intergenic
1180949704 22:19715488-19715510 TGCTGTGAGGCCCCTGGGGTGGG + Intronic
1181015055 22:20063928-20063950 CGCAGTGCACCCCGTGGGGTGGG - Intronic
1182665022 22:31951747-31951769 TGAAGTGAGTGCCCTGGGGTGGG + Intronic
1183211244 22:36452718-36452740 GGCTGTTATCACCCTGGGGTGGG - Intergenic
1184666252 22:45990652-45990674 TGCAGTGATCCCACCTGGGCTGG + Intergenic
950530081 3:13548303-13548325 TGCAGGGAGACCCCTGGGGGTGG + Intergenic
957298563 3:78362277-78362299 AGTAGAGATGCCCCTGGGGTAGG + Intergenic
961907416 3:130276946-130276968 TCCAGAGATCCCTGTGGGGTTGG - Intergenic
968939588 4:3631044-3631066 GGCAGTGTTCCTCCTGGGGTGGG + Intergenic
969312216 4:6360301-6360323 TGCAGCTTTCCCCATGGGGTGGG + Intronic
969392725 4:6901906-6901928 TCCAGTGAAGCCCCTGGGGCAGG + Intergenic
970322239 4:14886212-14886234 TCCAGAGCTCCCACTGGGGTAGG + Intergenic
975760286 4:77613446-77613468 TGCCCAGATCCCCCTGGGATTGG - Intergenic
977671172 4:99697492-99697514 TGCATTGATTCCTCTGGAGTAGG + Intergenic
982798126 4:159669320-159669342 TACACTGAGCCACCTGGGGTTGG + Intergenic
983980325 4:173987629-173987651 TGGAGTGAACCTTCTGGGGTTGG - Intergenic
984490676 4:180431037-180431059 TGCAGAGCTGCCCCTGGGGCGGG + Intergenic
985463915 4:190176604-190176626 TGCACTGATCACCCTGAGGAGGG - Intronic
985464429 4:190181319-190181341 TGCAGAGATCACCCAGGGGATGG - Intronic
985480585 5:107844-107866 TGCAGTGATCCGGGTGGGGCTGG + Intergenic
985527393 5:413865-413887 TGGAGTCATCCACCTGGGGCTGG - Intronic
985720677 5:1487057-1487079 TGCAGGGAGGCCCCTGGGGAGGG - Intronic
986073112 5:4306961-4306983 TGCTGAGATCTGCCTGGGGTGGG + Intergenic
986951801 5:13097004-13097026 TTCAGTGATTGCCCTGGGTTGGG + Intergenic
988552635 5:32210402-32210424 TTCCGTGAACCCCCTGGGGGGGG + Intergenic
990990074 5:61675657-61675679 CACAGTGTCCCCCCTGGGGTGGG + Intronic
993062016 5:83050004-83050026 TGAACTCATCCACCTGGGGTGGG + Intergenic
994087937 5:95780673-95780695 TACAGTGATCCCCATGCTGTAGG - Intronic
996209710 5:120792916-120792938 TCAAGTGATCCCCCTGGCCTCGG - Intergenic
997604267 5:135162927-135162949 TGCAGCCATCCCTCTGGAGTTGG + Intronic
999075191 5:148788992-148789014 TCCAGAGATCCCCATGGGATTGG + Intergenic
1000433094 5:161174529-161174551 TCCAGAGATCCCCTTTGGGTTGG - Intergenic
1001237773 5:170044571-170044593 TGGGGTAATCCCCCTGGGCTGGG - Intronic
1002293000 5:178212322-178212344 AGCAGTGATCACCCAGAGGTAGG + Intronic
1004695490 6:18029132-18029154 TCCAGAGATCCCCATGAGGTTGG - Intergenic
1004898470 6:20171690-20171712 TTCAGTGATACTGCTGGGGTTGG - Intronic
1012719222 6:102720260-102720282 TAAAGTGATCTCCCTAGGGTAGG - Intergenic
1013750730 6:113402817-113402839 TGCTGTGCTCCCCTTGGGGGAGG - Intergenic
1014437221 6:121434527-121434549 TTCAGTGATGCTCCTGAGGTTGG - Intergenic
1016833154 6:148452724-148452746 TGCAGTGCTGCCCCTGGTGAGGG + Intronic
1016977166 6:149820680-149820702 TGCAGTGCTACCCCTGGCGCTGG - Exonic
1024011403 7:45270050-45270072 TTCAGTGATGCCCCAGGGGCAGG + Intergenic
1024662820 7:51515049-51515071 TGCAGAGATCCACTTGGGCTTGG + Intergenic
1024716304 7:52083152-52083174 TCCAGTGATCCTCCTGTGCTAGG + Intergenic
1026858231 7:73768935-73768957 TGCAGAGCTCCCCCTCGGGGCGG - Intergenic
1029221532 7:98994478-98994500 TGCAGAGATGACCCTGGGCTGGG + Intronic
1032194574 7:129781578-129781600 TCCAGTTATCCACCTGGGGTGGG - Intergenic
1037738175 8:21583198-21583220 TGCAGTGACACCCATGGGGCTGG - Intergenic
1039951085 8:42173214-42173236 GGCAGTGAGGCCCCTGGGGATGG - Intergenic
1040379734 8:46860841-46860863 TTCAGTGATCCCCTTTGTGTGGG - Intergenic
1040576725 8:48658894-48658916 TGCAGAGATCGCCCTAGGTTGGG + Intergenic
1042439279 8:68806911-68806933 TGCAGTGATTTACCTGGGGCTGG + Intronic
1045687075 8:104723167-104723189 TGCAGGGATCCCACCAGGGTAGG - Intronic
1047416135 8:124666149-124666171 TAAACTGATCTCCCTGGGGTGGG + Intronic
1049188255 8:141270791-141270813 TCCAGGGAGCCCCCTGGGCTGGG - Intronic
1054451184 9:65404288-65404310 GGCAGTGTTCCTCCTGGGGTGGG - Intergenic
1054707404 9:68477019-68477041 TGAAGTGATCCCACTGGGCAGGG + Intronic
1057170689 9:92961235-92961257 TGAAGTGAGCCACCTGGGGGAGG + Intronic
1058021880 9:100098710-100098732 AGCAGTGTTCCCCCTGGGCGAGG + Intronic
1058936206 9:109771907-109771929 TGCGGTAATGCCTCTGGGGTGGG - Intronic
1060498786 9:124137300-124137322 TTCCCTGATCCCCCTGGGTTGGG + Intergenic
1060770370 9:126327437-126327459 GGCAGTGATGCTCCTGGGGCAGG - Intronic
1061445570 9:130635453-130635475 AGAAGTGGTCCCCCTGGTGTTGG + Intronic
1061952186 9:133942819-133942841 TGCAGAGACCACCCTGGGTTGGG - Intronic
1203736980 Un_GL000216v2:145962-145984 TGCACTGATCACCCTGTGGAGGG - Intergenic
1203737602 Un_GL000216v2:151547-151569 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203737825 Un_GL000216v2:153597-153619 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203738114 Un_GL000216v2:156332-156354 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203739840 Un_GL000216v2:169749-169771 TGTACTGATCACCCTGGGGATGG + Intergenic
1186086366 X:5994712-5994734 TGCAGTGATCCCTAAGGGATTGG + Intronic
1188574577 X:31631515-31631537 TTCAGAGATCCTCCTGGGGAAGG + Intronic
1189332397 X:40152050-40152072 TGCAGCGGTCCCCACGGGGTGGG + Intronic
1191650159 X:63528792-63528814 TGCAGAGAGCTTCCTGGGGTCGG + Intergenic
1193636007 X:83949378-83949400 TGCAGTGGCAGCCCTGGGGTTGG + Intergenic
1196121502 X:112056027-112056049 TGCAGTGATACCTGTGAGGTGGG + Intronic
1197839803 X:130734114-130734136 TGCAGAGATCCCTCTGGTGCAGG + Intronic
1199754905 X:150854907-150854929 TGCAGTGAACCACCGGGGGGAGG - Intronic
1201124838 Y:10903341-10903363 TGCAGTGATCACCCAGGTGACGG + Intergenic
1201176179 Y:11309591-11309613 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201177433 Y:11317669-11317691 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201178521 Y:11324030-11324052 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202624348 Y:56842226-56842248 TGCACTGATCACCCTGGTGATGG + Intergenic