ID: 1067704762

View in Genome Browser
Species Human (GRCh38)
Location 10:48598546-48598568
Sequence CCTTCTCTGCAGGTGGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067704755_1067704762 -7 Left 1067704755 10:48598530-48598552 CCCTGTGTCTCCCTCTCCTTCTC 0: 1
1: 0
2: 36
3: 344
4: 3281
Right 1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG No data
1067704750_1067704762 26 Left 1067704750 10:48598497-48598519 CCCAGCTCTCCATAGATCTGTTT 0: 1
1: 0
2: 2
3: 10
4: 234
Right 1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG No data
1067704756_1067704762 -8 Left 1067704756 10:48598531-48598553 CCTGTGTCTCCCTCTCCTTCTCT 0: 1
1: 0
2: 51
3: 1019
4: 3218
Right 1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG No data
1067704751_1067704762 25 Left 1067704751 10:48598498-48598520 CCAGCTCTCCATAGATCTGTTTC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG No data
1067704754_1067704762 -6 Left 1067704754 10:48598529-48598551 CCCCTGTGTCTCCCTCTCCTTCT 0: 1
1: 2
2: 32
3: 581
4: 5803
Right 1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG No data
1067704752_1067704762 17 Left 1067704752 10:48598506-48598528 CCATAGATCTGTTTCAACAAAGG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067704762 Original CRISPR CCTTCTCTGCAGGTGGCAGA CGG Intronic
No off target data available for this crispr