ID: 1067705409

View in Genome Browser
Species Human (GRCh38)
Location 10:48603569-48603591
Sequence CCCACTCCTGTGTAATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067705409_1067705414 3 Left 1067705409 10:48603569-48603591 CCAGCTCATTACACAGGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 93
Right 1067705414 10:48603595-48603617 GTGGAACTAAGCTCTCGCAGAGG No data
1067705409_1067705416 27 Left 1067705409 10:48603569-48603591 CCAGCTCATTACACAGGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 93
Right 1067705416 10:48603619-48603641 ATCTGGCTTGTCCTATCCCTTGG No data
1067705409_1067705415 10 Left 1067705409 10:48603569-48603591 CCAGCTCATTACACAGGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 93
Right 1067705415 10:48603602-48603624 TAAGCTCTCGCAGAGGTATCTGG No data
1067705409_1067705417 28 Left 1067705409 10:48603569-48603591 CCAGCTCATTACACAGGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 93
Right 1067705417 10:48603620-48603642 TCTGGCTTGTCCTATCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067705409 Original CRISPR CCCACTCCTGTGTAATGAGC TGG (reversed) Intronic
902561874 1:17282712-17282734 CCCTTTCCTGTGCAATGAGAAGG - Intronic
902634159 1:17724229-17724251 CCCACTCCTGTCTGAGGTGCGGG + Intergenic
905468828 1:38176246-38176268 CCCAGACATGTCTAATGAGCAGG + Intergenic
907130184 1:52090502-52090524 CTGGCTCCTGTGTAATGGGCTGG - Exonic
908062157 1:60363130-60363152 CCCATTCCTGTGAAAGGTGCTGG + Intergenic
909193238 1:72581754-72581776 CCCTCTCCTATGTAGTGATCAGG - Intergenic
910145429 1:84075266-84075288 CTCACTCCTGAGTAAAGAGGTGG + Intergenic
913176510 1:116277472-116277494 CCCAGTCCTGTCAAATGAGCTGG + Intergenic
913286081 1:117228161-117228183 CCCACTCCTGAGGACTGAGTAGG - Intergenic
917291498 1:173476816-173476838 TCCACTCCTCTGTAGGGAGCTGG + Intergenic
917722668 1:177800808-177800830 CCCACTGATGAGCAATGAGCAGG + Intergenic
921232102 1:213083461-213083483 CCCACTATTGTGTATTGAGTGGG + Intronic
922059237 1:222071917-222071939 CCCACACCTCTGTATTGAGCTGG - Intergenic
923474909 1:234323090-234323112 CCCACTCCTCTGGCAGGAGCAGG - Exonic
1065349862 10:24785630-24785652 CCCACTGCTGTGTAAGGCTCTGG + Intergenic
1067705409 10:48603569-48603591 CCCACTCCTGTGTAATGAGCTGG - Intronic
1070921347 10:80188442-80188464 CTCACAGCTGTGTAATGAGATGG - Intronic
1072315296 10:94196671-94196693 CCCACTCAGGTATAATGAGGTGG + Intronic
1076197023 10:128526163-128526185 CCCTCTCCTGTGTCTTCAGCGGG + Intergenic
1084791006 11:71475113-71475135 GCCACTCCTTTGAAATTAGCAGG + Intronic
1085564485 11:77500987-77501009 CCCAATCCCGGGTAATTAGCCGG + Intergenic
1088507478 11:110540660-110540682 CCCAATCCAGTGGAATGAGCTGG + Intergenic
1090158146 11:124463463-124463485 CCCACACCTCAGTAATGAGAGGG + Intergenic
1096196636 12:49652882-49652904 CCCAGCCATGTTTAATGAGCAGG - Intronic
1098216791 12:68228958-68228980 GCCACTCTTGTGTAATGTACAGG + Intergenic
1100325894 12:93539537-93539559 CCCGCTCATATGTAATGACCTGG - Intergenic
1101161756 12:101984687-101984709 CCCATTCCTGTGCAGTGACCTGG - Intronic
1102481825 12:113229045-113229067 CCCAGTCCTGTGTCAAGATCAGG + Intronic
1104171495 12:126286008-126286030 GCCACTCCTCAGGAATGAGCTGG + Intergenic
1104954727 12:132458633-132458655 ACCACTCCTGGACAATGAGCTGG - Intergenic
1110235955 13:73218365-73218387 CCCAGTTCTGTGTTAGGAGCTGG - Intergenic
1111746020 13:92270426-92270448 CCTGCTCCTGTGTAAAGTGCTGG + Intronic
1114533692 14:23410293-23410315 CCCGCTCCTGTGGAAGGAGGAGG + Intergenic
1114936025 14:27537678-27537700 AACATACCTGTGTAATGAGCAGG - Intergenic
1122953774 14:105060586-105060608 ACCTCTCCTGTCAAATGAGCAGG + Intronic
1131071574 15:89469831-89469853 CTCCCTCCTGTGCAATGTGCAGG - Intergenic
1133988217 16:10684591-10684613 CCCTGTCCTGCCTAATGAGCTGG + Intronic
1138417785 16:56881114-56881136 CCCACTCCTGCATAGGGAGCAGG - Intronic
1141903343 16:87006946-87006968 CCCTCTCCTGTGTGGGGAGCTGG + Intergenic
1144091111 17:11857397-11857419 CCATCTCCTGTGTTATTAGCAGG - Intronic
1147566479 17:41539342-41539364 CCCCCTCCAGTGGAATGTGCTGG + Intergenic
1148742657 17:49901709-49901731 CCCACCACTATGTAATGAGAAGG + Intergenic
1148753346 17:49958891-49958913 CTCACTCATGTGTACAGAGCAGG - Intergenic
1148779846 17:50115218-50115240 CCCACTCCTGTGTGAGGAGCTGG - Intronic
1149659811 17:58328311-58328333 CCCACTTCTGTGTGTTGAGGGGG + Intronic
1151390498 17:73783921-73783943 CCCACCCCAGCGGAATGAGCTGG + Intergenic
1152843259 17:82583844-82583866 CCTACGCCTGTGAACTGAGCGGG - Intronic
1157993348 18:52524432-52524454 CCCATTTCAGTGTAATAAGCAGG - Intronic
1160267621 18:77353862-77353884 CCCATTCCTGTGTAATCTGAAGG + Intergenic
1166392870 19:42419647-42419669 CCGACTCCTGGGGACTGAGCAGG + Intronic
926707975 2:15850066-15850088 CCCACTTCTGTGTCACCAGCTGG - Intergenic
927694644 2:25231486-25231508 TTTACTCCTGAGTAATGAGCAGG + Exonic
930579684 2:53195269-53195291 GCCACTCCTGTGGAATAAGTAGG - Intergenic
931459698 2:62439944-62439966 TCCTCTCCTGTGTTATGAGTTGG - Intergenic
933748946 2:85590931-85590953 CCCAGTCCTCTGAAATGAGCTGG + Intronic
935535293 2:104286380-104286402 GCCACTACTCTGTGATGAGCAGG + Intergenic
938549747 2:132369094-132369116 CCCACTCCTTTGTCTTGAGATGG - Intergenic
941922327 2:170863706-170863728 CTGCCTCCTGTGCAATGAGCTGG - Intergenic
1169346060 20:4828886-4828908 CCCATTCCTGAGTACTGGGCTGG - Intergenic
1170392943 20:15894952-15894974 GCCACACTTGGGTAATGAGCTGG + Intronic
1173379723 20:42529326-42529348 ACCACGACTGTCTAATGAGCCGG + Intronic
1175835548 20:61991837-61991859 CGCACTCCAGTGGGATGAGCCGG + Intronic
1178681131 21:34672629-34672651 CCCACACCTGTGTTCTGCGCTGG - Intronic
1178921094 21:36738717-36738739 GGCAATCCTGTGAAATGAGCTGG + Intronic
1179383914 21:40924316-40924338 CCCACCCTTGGGTGATGAGCAGG - Intergenic
1179552928 21:42154783-42154805 GCCAGTCCTGTGGAATGTGCAGG + Intergenic
1181148214 22:20863922-20863944 CACACTAGTATGTAATGAGCTGG + Intronic
1181685174 22:24523170-24523192 CCCACACATGTGTAAGGAGCAGG - Intronic
949582349 3:5401296-5401318 CCCCCTCCTGTGTTCTTAGCAGG + Intergenic
950177061 3:10882236-10882258 CCCACTTCTGCATAAAGAGCAGG - Intronic
952325043 3:32313352-32313374 CGTATTCCTGTGTAGTGAGCTGG + Intronic
953979546 3:47406814-47406836 CCCCCTGGTGTGTAAGGAGCGGG - Intronic
956878998 3:73491364-73491386 ACCACTCCTGGGTTCTGAGCTGG + Intronic
961626346 3:128266479-128266501 CACACTGCTGTAAAATGAGCTGG - Intronic
962881243 3:139578838-139578860 CACTCTCCTGTGTGATGACCAGG - Intronic
965991341 3:174822281-174822303 CCAGCTCCTGTGCAATAAGCAGG - Intronic
966157315 3:176930781-176930803 CCCACTCCTGTGTTTACAGCAGG - Intergenic
971494356 4:27248302-27248324 CCCACTCCAGTGTAAGCAGCAGG - Intergenic
972982280 4:44720470-44720492 CCCAGTTCTGTGTAAGGAGATGG + Intronic
973843745 4:54889857-54889879 CCCTCTCCTGTGTTATGAAAAGG - Intergenic
974066568 4:57083292-57083314 CCCACTGCTGGGAAATGTGCAGG - Intronic
979109917 4:116740064-116740086 ACCATTCCTGGGTAATGATCAGG - Intergenic
981313348 4:143317834-143317856 CCCACTCCTGTGGATTGAGATGG + Intergenic
986387074 5:7244986-7245008 CCAAATCCTGTGTGATGAACTGG - Intergenic
996496500 5:124162892-124162914 CCCACTCCTGTGTAGAGCGTTGG + Intergenic
1003517032 6:6826153-6826175 CCCACTCCACTGTTAAGAGCTGG - Intergenic
1017773131 6:157658528-157658550 CCCAATCCTGTGTCAAGTGCGGG - Intronic
1027214675 7:76176119-76176141 CCAGGTCCTGTGTAAGGAGCTGG + Intergenic
1030181840 7:106717714-106717736 TCCACTCCTGTCCAATAAGCAGG - Intergenic
1039722025 8:40174458-40174480 CCCACTCCTGATTCATGGGCAGG + Intergenic
1039823916 8:41157104-41157126 CAGACTCCTGTGTAATGATCAGG + Intergenic
1040047616 8:42979443-42979465 CCCACTCCTTTGTTATCAGCTGG + Intronic
1046850830 8:118971116-118971138 CCCACTCCTACATAATGAGGAGG - Intergenic
1047001484 8:120577560-120577582 TCCAGTCCTATTTAATGAGCTGG - Intronic
1047367595 8:124226425-124226447 CCCAGTCTTGTGTAACAAGCAGG + Intergenic
1049232502 8:141491788-141491810 TCCACTCCTGCGGAATGGGCAGG + Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1053462557 9:38281906-38281928 TTCCCTCCTGTGAAATGAGCTGG + Intergenic
1057891596 9:98874134-98874156 CCCACCCCTGTGCCATCAGCTGG + Intergenic
1061258202 9:129465003-129465025 CCCAGCCCTGTGAGATGAGCTGG - Intergenic
1062115965 9:134809102-134809124 CCCTCTCTTGGGTAATGAGCTGG + Intronic
1062136210 9:134929748-134929770 CCCATGCCTGTGTGAGGAGCAGG + Intergenic
1062392295 9:136338681-136338703 CCAGCTCCTGGGCAATGAGCAGG - Exonic
1187243393 X:17533112-17533134 CACACTCCTGTGTGGTGGGCGGG - Intronic
1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG + Intergenic