ID: 1067705655

View in Genome Browser
Species Human (GRCh38)
Location 10:48604895-48604917
Sequence GTTCGGGGCCCCGTGGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067705644_1067705655 27 Left 1067705644 10:48604845-48604867 CCACTTGCTTTTGCTCGTCCTCG 0: 1
1: 0
2: 1
3: 3
4: 171
Right 1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 92
1067705646_1067705655 2 Left 1067705646 10:48604870-48604892 CCTAGTCGCCCCTCATGTCCTGC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 92
1067705645_1067705655 9 Left 1067705645 10:48604863-48604885 CCTCGCGCCTAGTCGCCCCTCAT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 92
1067705649_1067705655 -7 Left 1067705649 10:48604879-48604901 CCCTCATGTCCTGCTCGTTCGGG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 92
1067705651_1067705655 -8 Left 1067705651 10:48604880-48604902 CCTCATGTCCTGCTCGTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 92
1067705647_1067705655 -6 Left 1067705647 10:48604878-48604900 CCCCTCATGTCCTGCTCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067705655 Original CRISPR GTTCGGGGCCCCGTGGCCGC TGG Exonic
900283912 1:1890496-1890518 GGCCGGGGCCCCGGGGGCGCGGG - Intronic
901077311 1:6563349-6563371 ATTCACGGCCCTGTGGCCGCCGG - Intronic
901743146 1:11355608-11355630 CTTCTGGGCCCCGTGCCCCCCGG + Intergenic
901836197 1:11925735-11925757 GGTCCTGGCCCCGTGGCCGCCGG - Exonic
905202153 1:36322603-36322625 GAGCCGGGCCCCGGGGCCGCGGG + Exonic
907515681 1:54991885-54991907 GTTGGGGGCCCCTCGGCCACTGG - Exonic
913554215 1:119948799-119948821 CTTCGGGGCCCCCTAGCGGCTGG - Intronic
920021272 1:202958252-202958274 GATCGGGGCCGCTCGGCCGCAGG - Exonic
921384021 1:214551702-214551724 GGTGGGGGAGCCGTGGCCGCCGG - Intronic
1063881613 10:10537907-10537929 CTTGGGGGGTCCGTGGCCGCGGG + Intergenic
1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG + Exonic
1077047194 11:551853-551875 GTTCGGGGCCGAGGGGCTGCAGG - Intronic
1078762274 11:14260793-14260815 GTTCGGGGCTCCCTGGACTCAGG - Intronic
1083572656 11:63768636-63768658 GAGCGGGGCCCCGGGGCGGCGGG + Exonic
1083929544 11:65833356-65833378 GCTTGGGGCGCCCTGGCCGCGGG + Intronic
1102822132 12:115917116-115917138 AGTCGGGGCCCCCGGGCCGCGGG - Intergenic
1104280329 12:127371015-127371037 GTTCCGGGCCCACTGGCTGCTGG - Intergenic
1107359296 13:39602508-39602530 GATGGGGGCCCCCTGCCCGCAGG - Intronic
1112328432 13:98459394-98459416 GTTCAGGGCCCGGTGGGAGCAGG - Intronic
1113379300 13:109787257-109787279 GTTCCAGGGCCCGCGGCCGCGGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1123021133 14:105398469-105398491 GTTCTGGGCTCCGTTGCGGCGGG - Intergenic
1128866115 15:71116029-71116051 GGTCGGGGCCCCGTGCTCCCCGG + Intronic
1132554000 16:564761-564783 GCACTGGGCCCCGTGGCTGCAGG - Exonic
1133168742 16:3966921-3966943 GTTCGGTGCCGCGTGACCTCCGG - Exonic
1134531831 16:14989658-14989680 GGTCCTGGCCCCGTGGCCGCCGG - Intronic
1139440274 16:66963294-66963316 GGTCAGGGCCCAGTGGCGGCTGG - Exonic
1140859802 16:79008824-79008846 GATCGGGGCCCCCTGGTCTCCGG - Intronic
1143863074 17:9905230-9905252 GTGCGTGGTCCCCTGGCCGCAGG + Exonic
1144778507 17:17796548-17796570 GTTTGGGGACCCTTGCCCGCTGG - Exonic
1145765537 17:27456323-27456345 GTCCGGGGCCCCGAGGGCGGAGG + Intergenic
1146646586 17:34580760-34580782 GTCCGGAGCCCGGTGGCCGCGGG - Exonic
1147139573 17:38453765-38453787 CTTCGGGGCCCCCGGGCCCCGGG + Intronic
1147720349 17:42536184-42536206 CTTCGGGTCCACGTGGCCGGAGG + Exonic
1148559247 17:48596700-48596722 GTCCTGGGCCCGGTGACCGCAGG - Intronic
1152720732 17:81922687-81922709 GCCCGGGGCCCCCTTGCCGCCGG - Exonic
1152822851 17:82446000-82446022 AACGGGGGCCCCGTGGCCGCTGG + Intronic
1156502063 18:37566290-37566312 ATTCCGGGCCCGGCGGCCGCGGG + Intergenic
1160607158 18:80059722-80059744 GCTTGGGGCCCCCTGGCTGCAGG + Intronic
1160780716 19:876865-876887 GGTGGGGGCCCCGTGGCAGGTGG - Intronic
1160780733 19:876900-876922 GGTGGGGGCCCCGTGGCAGGTGG - Intronic
1160930438 19:1567577-1567599 GTCGGGGGCCCCAGGGCCGCGGG + Exonic
1161175902 19:2841927-2841949 CTTCGGGACCCCCGGGCCGCGGG + Intronic
1163547295 19:17947972-17947994 GGGCGGGGCCGCGGGGCCGCCGG + Intergenic
1163767189 19:19170261-19170283 GATCAGGGGCCCGCGGCCGCAGG + Intronic
1164674321 19:30091585-30091607 GGTGGGGGCCCCATGGCCCCAGG - Intergenic
1166524748 19:43504105-43504127 CTTCGCGTCCCCATGGCCGCTGG + Exonic
1166883019 19:45940398-45940420 GTCCTGGCCGCCGTGGCCGCCGG - Exonic
1168076292 19:53982443-53982465 GCCCGGGCCCCCGGGGCCGCCGG - Exonic
930096572 2:47570671-47570693 GCCCGGGGCCCCGCGGACGCCGG - Exonic
931671739 2:64653941-64653963 GCTCCGGGCCCCGGCGCCGCAGG + Intronic
933721116 2:85398351-85398373 GTTCGGGGCCCCTGTGCTGCAGG - Intronic
941008370 2:160270336-160270358 GATGGGGGTCACGTGGCCGCGGG - Intronic
941112124 2:161427191-161427213 GCTCGAGGCCGCGGGGCCGCGGG + Intronic
946921349 2:224584904-224584926 GTCCGGGACCCCGGGGCCGGGGG - Intronic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
1171430691 20:25081751-25081773 GCTCGGGGCCCCTGGGCGGCAGG + Exonic
1174204265 20:48827813-48827835 GTCCCCGGCCCCGTCGCCGCCGG + Exonic
1174658511 20:52191485-52191507 TTTCGGGGCCCCGGGCCTGCTGG + Intronic
1175902895 20:62366971-62366993 GTAGGGGGCCCCGTGGCCGGCGG - Exonic
1175992814 20:62797843-62797865 GTTCCAGGCCCTGTGGCAGCAGG + Intronic
1179786623 21:43733947-43733969 GCTGGGGGCCCCGTGCCAGCCGG + Intronic
1180064775 21:45406660-45406682 GGTCTGGGCCCTGTGGGCGCTGG - Intronic
1180074816 21:45456991-45457013 GTTCAGGGGCCCGTGGCCCTCGG + Intronic
1181026788 22:20131632-20131654 GCTGGGGTCCCCGAGGCCGCGGG + Intronic
1181570784 22:23767001-23767023 GGTCTGGGCACTGTGGCCGCTGG - Intronic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1183368524 22:37419635-37419657 GTTGGGGGCCCCGTGTCCCTGGG - Intronic
1185051336 22:48555800-48555822 GATGGGGGCGCTGTGGCCGCTGG + Intronic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
950534333 3:13570590-13570612 GTGCGCGGCCGCGTGCCCGCCGG + Exonic
953237658 3:41120331-41120353 CTTCGGGACCCAGTGGCCCCGGG - Intergenic
954097316 3:48338715-48338737 GCTTGGGGCCCAGTGGCTGCAGG - Intergenic
962750999 3:138434815-138434837 GCTGGGGGCCCCGGGGGCGCAGG - Exonic
964482811 3:157159653-157159675 GTTCGGGGCCCAGCCGCGGCCGG - Intronic
966852082 3:184170621-184170643 CCTGGGGGCCCCATGGCCGCGGG - Exonic
967329494 3:188276435-188276457 GTTCGTGGCCCTGGGGCCTCTGG + Intronic
968624688 4:1621820-1621842 GTGGGGAGCCCCATGGCCGCAGG - Intronic
968812676 4:2807055-2807077 GTTCGGGGCTCAGAGGCCCCAGG - Intronic
971351815 4:25862618-25862640 GCGCGGGGCCCCGGGGACGCGGG - Intronic
973849641 4:54948434-54948456 TTTCTGGGCCCCTTGGCCACTGG + Intergenic
983784650 4:171716040-171716062 GTTTGGGGCCCCATGGTCCCTGG + Intergenic
985515846 5:344172-344194 GCTCAGGGCCCCGAGGGCGCAGG - Intronic
989475770 5:41870741-41870763 GTTCAGGGCCCTCCGGCCGCGGG + Intergenic
998108167 5:139481645-139481667 CTTCTGGGCCCCGTGACCCCTGG + Exonic
1007623581 6:43229497-43229519 GGGCGGGGTCACGTGGCCGCGGG - Intergenic
1011734042 6:90295505-90295527 GTTCGGGAGCCCGGCGCCGCTGG - Intronic
1014230213 6:118894612-118894634 GTTCGGCGCCTGGCGGCCGCGGG + Intronic
1019719417 7:2559281-2559303 GCGCGGGGCCCCGAGGCTGCGGG - Intronic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1029445941 7:100612829-100612851 GTCCGGGGCCCCCTGGGCGGGGG + Exonic
1031484616 7:122311881-122311903 CCTCGGGTCACCGTGGCCGCGGG - Intergenic
1039627794 8:39072614-39072636 GTGCAGAGCCCTGTGGCCGCAGG - Intronic
1039885951 8:41653997-41654019 GTCAGAGGCCCCCTGGCCGCGGG - Intronic
1060827471 9:126695234-126695256 GTGGGGGTCCCCGAGGCCGCTGG - Intronic
1061920931 9:133781980-133782002 GCTTGGGGCCTCGTGGCAGCTGG + Intronic
1062008086 9:134251559-134251581 GCTCCCGGCCCCGGGGCCGCTGG + Intergenic
1191213268 X:57910267-57910289 CTTGGGGGCCCCGGGGCAGCAGG + Exonic
1197746075 X:129932705-129932727 CCTCGGCGCCCCGTGGCCGCAGG + Intergenic
1201634165 Y:16103921-16103943 GTTAGGGGCCACGTGGCCTCTGG - Intergenic