ID: 1067707894

View in Genome Browser
Species Human (GRCh38)
Location 10:48624545-48624567
Sequence ACATTGGGATGGAGCTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067707894 Original CRISPR ACATTGGGATGGAGCTTAAA TGG (reversed) Intronic
901909240 1:12441274-12441296 AAATGGGGATGGAGTTGAAAAGG + Intronic
903797514 1:25940902-25940924 GCATTGGGGTGGAGCTCAGAAGG + Intergenic
905176044 1:36135977-36135999 AGCTTGGGATAGATCTTAAAAGG - Intergenic
907282862 1:53362396-53362418 ACAATGGGGTGGAGCAGAAAAGG - Intergenic
908092118 1:60697301-60697323 AAATTGGGACAGAGCTAAAAAGG + Intergenic
908528456 1:65010556-65010578 ACATTTGGTAGGAGCTTAACTGG - Intergenic
914689316 1:150011009-150011031 CCGTTGGGAAGGAGCTGAAAGGG + Intergenic
915921950 1:159982464-159982486 ACATTTGCATGGATCTTAATAGG - Intergenic
921341784 1:214141068-214141090 AATTTTGGATAGAGCTTAAAGGG + Intergenic
922226039 1:223646630-223646652 ACATGTGGATGGTTCTTAAAGGG - Intronic
1067281614 10:44877513-44877535 TTCCTGGGATGGAGCTTAAAAGG + Intergenic
1067707894 10:48624545-48624567 ACATTGGGATGGAGCTTAAATGG - Intronic
1068633935 10:59327631-59327653 ACAGAGTGATGAAGCTTAAATGG - Intronic
1071726230 10:88200595-88200617 ACATTGCTATGGAGAATAAATGG - Intergenic
1075163391 10:120044133-120044155 TTATTGGGATGGTGGTTAAACGG - Intergenic
1076297714 10:129400069-129400091 ACATTGGGAAGGAGATTAAACGG - Intergenic
1081327422 11:41762390-41762412 ACAATGGGAAGGAGTATAAATGG + Intergenic
1083550867 11:63589372-63589394 ACATTGGGAAGGTTCTTACATGG - Intronic
1084841710 11:71856851-71856873 ACAGTGGCATGAAGCTTTAATGG + Intergenic
1087526377 11:99319128-99319150 GCACTGGGTTGAAGCTTAAATGG + Intronic
1088916528 11:114232089-114232111 ACATCGGGACGGAGCATGAAAGG - Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1093144610 12:15550496-15550518 ACATTGTCATGGAGCTGACAAGG - Intronic
1093791850 12:23260802-23260824 ACATTGAGATAGAGCAGAAAAGG + Intergenic
1097251873 12:57638879-57638901 GAATTGGGATAGGGCTTAAATGG - Intergenic
1098249055 12:68549791-68549813 AAATAGGGAGGTAGCTTAAAGGG - Intergenic
1102741702 12:115213421-115213443 ACAAGGGGATGGTGCTTAGAAGG + Intergenic
1107570343 13:41650850-41650872 ACATTGGCATGCAGCCTTAAAGG + Intronic
1109330089 13:60918537-60918559 CCATAGGGATGGAGCTTCATGGG - Intergenic
1111460064 13:88527558-88527580 ACATTGGTTGGGAGATTAAAAGG - Intergenic
1111615770 13:90659748-90659770 ACCTAGGAATGCAGCTTAAAAGG + Intergenic
1117053659 14:51888147-51888169 ACATTGAGATGGAGATAGAAGGG - Intronic
1118933790 14:70266931-70266953 ACATAGGGAAGTAACTTAAAAGG + Intergenic
1121374380 14:93393952-93393974 AAATTGGAATGGAGTTTGAATGG - Intronic
1122335700 14:100979323-100979345 ACATTGGAATGGATAATAAATGG + Intergenic
1122482383 14:102055502-102055524 ACATGGGGGTGGAGCTTAATTGG - Intergenic
1128800969 15:70496720-70496742 AGATGCGGCTGGAGCTTAAAGGG - Intergenic
1128945791 15:71819709-71819731 ACATTGGGAAGGAGATTTGAGGG + Intergenic
1132067475 15:98744154-98744176 TTCTGGGGATGGAGCTTAAAGGG + Intronic
1132364591 15:101248277-101248299 CAATTGGGATGGAGGTTATAGGG - Intronic
1137629944 16:49936085-49936107 TCATGGGGAGGGAGCTCAAAGGG + Intergenic
1137898398 16:52238289-52238311 GCAGTGGGATGGGGCTTATAGGG + Intergenic
1138290357 16:55841459-55841481 GCCTTGGGGTGGAGCTCAAAGGG - Intergenic
1138408172 16:56815719-56815741 GGATTGGGATGAAGATTAAATGG - Intronic
1139282239 16:65780801-65780823 ACAATGGGATGGATTTTGAAGGG - Intergenic
1139665756 16:68454275-68454297 ACATTGGCATGGAGCTACCAGGG - Intergenic
1144422867 17:15113994-15114016 AAATTGAGATGGATGTTAAAGGG - Intergenic
1145188406 17:20816792-20816814 CCATTGAGATGGAGCTGCAATGG - Intergenic
1148963460 17:51413329-51413351 ACATTGGGCTGAAGCATCAATGG + Intergenic
1149500038 17:57145693-57145715 ACTGAGGCATGGAGCTTAAATGG + Intergenic
1153824308 18:8861449-8861471 ACACTGGGAAGCAGCTTGAAGGG + Intergenic
1160258848 18:77272062-77272084 AGATTGGGATGGGGCGGAAATGG - Exonic
931761960 2:65425736-65425758 ACATTGTGATGGTGCTTTTAAGG - Intronic
936841510 2:116775115-116775137 ACAATGGTGTGCAGCTTAAAAGG - Intergenic
936961954 2:118085389-118085411 ATATTGTGATGGAGAATAAAGGG - Intergenic
945333471 2:208565264-208565286 AAATTGGGATTGAGATTGAAGGG + Intronic
946599701 2:221346069-221346091 ACATTGGGGTAGATCTTATAAGG - Intergenic
947022941 2:225703264-225703286 ATATTGGAATGGATGTTAAATGG - Intergenic
948027385 2:234789088-234789110 TCACTGGAATGGAGCTTTAATGG - Intergenic
1170740463 20:19051522-19051544 ACACTGGGAAGGAGCTGAGAGGG - Intergenic
1175137519 20:56835786-56835808 ACATTTGGATTGAACATAAATGG + Intergenic
1175595978 20:60233183-60233205 ACATTGAGATGAATCTTCAAAGG - Intergenic
1178257324 21:31066211-31066233 AAAGTGTGATGCAGCTTAAAGGG + Intergenic
1178357041 21:31918277-31918299 AAATTGAGAGGGAGCTTAATAGG + Intronic
1179342017 21:40520894-40520916 ACATGAGAATTGAGCTTAAATGG + Intronic
1181505251 22:23351776-23351798 GCCTTGGGGTGGAGCTCAAAGGG + Intergenic
1182095554 22:27623031-27623053 CCACTGGGATGGAGGTTCAAAGG + Intergenic
949965675 3:9354094-9354116 ACATTGGGTTGTAGCTATAATGG + Intronic
951775259 3:26303282-26303304 AAATTCGCATGGAGCTAAAAAGG - Intergenic
956232062 3:67028698-67028720 ACAAAGGGATGGTGCTTAGACGG - Intergenic
957328211 3:78724215-78724237 ACATTGAAATGGATCTTAAAAGG + Intronic
957700330 3:83701960-83701982 ACATAGGGATGCAACTTACAAGG - Intergenic
958472139 3:94534070-94534092 ACTTTGGGAAGGAGCTTGACTGG - Intergenic
959391419 3:105779659-105779681 TCATTCTGTTGGAGCTTAAAAGG + Intronic
961332330 3:126149861-126149883 ACAGTGGGAGGGAGCATGAAGGG + Intronic
963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG + Intronic
963187337 3:142433660-142433682 ACATTAAGATGGAACTGAAATGG + Intronic
966333882 3:178846625-178846647 GTATTGGTATGGGGCTTAAATGG + Intergenic
969106937 4:4813987-4814009 ACCTAGGGATGGAGCTAACAAGG + Intergenic
969782811 4:9422884-9422906 ACAGTGGCATGAAGCTTTAATGG + Intergenic
970224208 4:13840460-13840482 ACATCTGGTTGGAGTTTAAAAGG - Intergenic
971507943 4:27386710-27386732 ATATTGGAATGGAGTTAAAAAGG - Intergenic
973757121 4:54086348-54086370 AGGTTGGGATGGAGATGAAATGG - Intronic
976349887 4:84049240-84049262 ACATTTGGATGGCACTTTAAAGG + Intergenic
976471443 4:85433824-85433846 ACAGTGGGATGGGGCTGAGAGGG + Intergenic
977878436 4:102176589-102176611 AAGTTGGGATGGTGCTTCAAAGG + Intergenic
978042104 4:104079779-104079801 CCATTGTGATGGAGCTCAAAAGG + Intergenic
979578649 4:122328141-122328163 ATAATGGGATGGACCTTCAATGG - Exonic
981433191 4:144686506-144686528 AAATTGGGATGGAGAACAAAAGG + Intronic
983180833 4:164646516-164646538 ACAATGGGATGGAGGTTGGATGG + Intergenic
984395852 4:179199154-179199176 AAATTGGGATGGAGTGAAAAAGG - Intergenic
985035989 4:185840514-185840536 AGATTGGAATGGAACTAAAAGGG - Intronic
986587595 5:9335061-9335083 ACATTGGGATGGAGACTCTAGGG + Intronic
986587603 5:9335107-9335129 ACATTGGGATGGAGACGACAGGG + Intronic
990808766 5:59698160-59698182 ACTTTGGCTTGGAGGTTAAATGG + Intronic
992524656 5:77596868-77596890 ACTTTGGGAGGGAGGTTAAGGGG + Intronic
992562981 5:77971133-77971155 ACAATCAAATGGAGCTTAAAGGG + Intergenic
993061960 5:83049451-83049473 AAATTTGGATGGAGCAGAAAAGG + Intergenic
998997251 5:147879086-147879108 ATATTGGGCTAGAGCTTAGATGG - Intronic
1000958854 5:167574909-167574931 GCTTTGGGGTGAAGCTTAAAAGG + Intronic
1002781085 6:366729-366751 ACAGTGGGGTAGAGGTTAAAAGG + Intergenic
1003723507 6:8733102-8733124 ACACTTGAATGGAGCTTAATTGG + Intergenic
1004560051 6:16740922-16740944 ATATTGAGATGGAGCTGGAATGG - Intronic
1004838232 6:19552872-19552894 TGATTGGGATTGAGCTGAAATGG - Intergenic
1006936925 6:37725056-37725078 AAGTTGGGATGGAGCTGCAATGG + Intergenic
1013591994 6:111626716-111626738 ACATTGGGATGAAGTGTAGATGG + Intergenic
1013650459 6:112189380-112189402 TCATTGGGCTGGAGCTTAATCGG - Intronic
1013956185 6:115843786-115843808 AAAATGGGATGGGGCATAAATGG - Intergenic
1014914097 6:127124207-127124229 ACATTGGGATGGAGACAAAGGGG - Intronic
1015356189 6:132279824-132279846 GCATTTGGATGGAGATGAAACGG + Intergenic
1018070211 6:160157923-160157945 ACATTGGGAGGCAGCTTCTATGG + Intronic
1021172700 7:17416245-17416267 ACCTTGGGCTGGAGCTTTAGGGG - Intergenic
1021208732 7:17817192-17817214 ACATTTGGATGCACCTTCAAAGG + Intronic
1021475138 7:21052295-21052317 ACATTCTGATGGTACTTAAATGG - Intergenic
1023986344 7:45099361-45099383 ACAGTGGGGTGGAGCTGAGATGG - Intergenic
1031170037 7:118281830-118281852 ACAGCTGGATGGAGCTTGAATGG + Intergenic
1031470153 7:122159056-122159078 GCATTGGGATGCAGTTTAAGTGG - Intergenic
1036836254 8:12071151-12071173 ACAGTGGCATGAAGCTTTAATGG - Intronic
1036858096 8:12317720-12317742 ACAGTGGCATGAAGCTTTAATGG - Intergenic
1038971738 8:32644290-32644312 TTACTGGGGTGGAGCTTAAAGGG + Intronic
1043620769 8:82190081-82190103 TTATTTAGATGGAGCTTAAAAGG + Intergenic
1044068951 8:87731615-87731637 TCAATGGGATGGAGATTACAGGG + Intergenic
1044315562 8:90746667-90746689 TCTTTGGGATGCAGCTAAAATGG - Intronic
1045803866 8:106133976-106133998 GCATTGTGATGGATTTTAAAGGG + Intergenic
1046204132 8:110967810-110967832 ACATTGGGTTGGTGGTTACATGG - Intergenic
1046410444 8:113834999-113835021 AAATTAGGATGAAGCTTAAGTGG - Intergenic
1047448839 8:124944209-124944231 AGATTGGGTTGGAGCACAAAAGG - Intergenic
1048865624 8:138759426-138759448 ACATTGGGTTGGAGAATAACTGG - Intronic
1050724563 9:8633215-8633237 GCATTGTGATGGTGCTTAAATGG - Intronic
1051162650 9:14225685-14225707 GCATAGGCATGGGGCTTAAAGGG + Intronic
1052503307 9:29320525-29320547 AGATTGGAAGGGAGGTTAAAGGG + Intergenic
1057503402 9:95613655-95613677 ACATTGAGATGGACTTTGAAGGG + Intergenic
1058188850 9:101888979-101889001 ACATTGGGAAGGTGGTTTAAGGG + Intergenic
1062189512 9:135240617-135240639 ACATTGGGATGGAGCAGAGATGG - Intergenic
1187089406 X:16079411-16079433 AGATTGTCATGGAGGTTAAAGGG + Intergenic
1188110210 X:26188737-26188759 ACACAGGGATGGAGTTTTAATGG - Intergenic
1189634071 X:42986292-42986314 ACATTGGAATGGAAATAAAATGG - Intergenic
1190619911 X:52276527-52276549 ACATGAGGCTGAAGCTTAAAAGG + Intergenic
1196482554 X:116166455-116166477 ATATTGGGATGGAGATGAAGAGG + Intergenic
1196652177 X:118179170-118179192 TCATAGAGATGGAGCTTACAGGG - Intergenic
1200752307 Y:6957537-6957559 GCATTGTGATGGAGCTTTACTGG + Intronic
1202246300 Y:22823703-22823725 ACATTGGGATTGACCTAATAGGG + Intergenic
1202399288 Y:24457451-24457473 ACATTGGGATTGACCTAATAGGG + Intergenic
1202471492 Y:25212635-25212657 ACATTGGGATTGACCTAATAGGG - Intergenic