ID: 1067710574

View in Genome Browser
Species Human (GRCh38)
Location 10:48648358-48648380
Sequence CACTGCCCCAATCAACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067710574_1067710577 28 Left 1067710574 10:48648358-48648380 CCTTGCAGTTGATTGGGGCAGTG 0: 1
1: 0
2: 3
3: 17
4: 119
Right 1067710577 10:48648409-48648431 GTGTGATGTGTGTCCCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067710574 Original CRISPR CACTGCCCCAATCAACTGCA AGG (reversed) Intronic
900870401 1:5298112-5298134 CACAGCACCACTCAACTGCAAGG - Intergenic
904856207 1:33499948-33499970 CCCTGCCCCAATCTGCTACAAGG + Intergenic
905991044 1:42337005-42337027 CTCTTCCCCAGACAACTGCATGG - Intergenic
923626180 1:235615805-235615827 CACTGCCACAGTGAACTGGATGG + Intronic
1065524159 10:26601474-26601496 CACTGCCCCCAGCCACAGCAAGG + Intergenic
1065967772 10:30783178-30783200 CACAGCACCAATGACCTGCATGG + Intergenic
1067710574 10:48648358-48648380 CACTGCCCCAATCAACTGCAAGG - Intronic
1067752312 10:48979689-48979711 CACTGCCAGAATCAACTGAATGG - Intronic
1068669937 10:59712107-59712129 AATTGCCCCCATCATCTGCAGGG + Intronic
1070690044 10:78517737-78517759 CACTGCCCCAACCATCTCCCAGG + Intergenic
1071602959 10:86967864-86967886 CCCAGCCCCAAACAGCTGCAGGG - Intronic
1071778661 10:88817845-88817867 CACTCCCCCAGTCAAATGCCCGG - Exonic
1074848900 10:117422733-117422755 CACTGGACCACTCAAGTGCATGG - Intergenic
1075832476 10:125423294-125423316 CTCTGCCCCACTCCAATGCAGGG - Intergenic
1075921668 10:126218518-126218540 CACAGACCCAAGCACCTGCAGGG - Intronic
1076396484 10:130141939-130141961 CAGGGCCCCAGACAACTGCAAGG + Intronic
1083029412 11:59578316-59578338 CACTTCCCCCGTCACCTGCAAGG + Exonic
1087800183 11:102495395-102495417 CAATGCCCCAATCAACAAAAAGG - Intronic
1098244280 12:68500360-68500382 CACTGCCCCAGTCAACATAAAGG + Intergenic
1099308048 12:80982877-80982899 CCCTGCCCCAAACATCTGAATGG + Intronic
1102643999 12:114391840-114391862 CACTTTCCCAGTCAAGTGCAGGG - Intronic
1107388938 13:39943031-39943053 CAATTCCCCAATCAACTCCATGG - Intergenic
1107421738 13:40253791-40253813 CACTGCCCCAATCCACACCAGGG - Intergenic
1108201755 13:48050958-48050980 TACTCCGCCAATCAACTGAATGG + Intergenic
1109030152 13:57180125-57180147 CCCAGCCCCAACCAACTCCATGG + Intergenic
1109382971 13:61589073-61589095 CACTTCCCAACTCAGCTGCAGGG + Intergenic
1115677819 14:35699966-35699988 CACTTCCAGAATGAACTGCAAGG + Intronic
1120665123 14:87296990-87297012 CACTCCCCTCATCAACTGCGGGG - Intergenic
1121007200 14:90498069-90498091 CTCTGCCCCGACCAGCTGCAAGG + Intergenic
1128583764 15:68829138-68829160 CATGGCCCCAACTAACTGCAAGG - Intronic
1128665519 15:69535213-69535235 CACGGCCCCACCCAACCGCAAGG - Intergenic
1132660783 16:1060644-1060666 CCCGGCCCCAGTCAGCTGCATGG + Intergenic
1133303962 16:4798653-4798675 CACTGCGTCCATCAGCTGCAGGG + Exonic
1134181923 16:12054702-12054724 AACTGCTCCACACAACTGCAGGG - Intronic
1139272545 16:65697753-65697775 CACAGCCTCAAGCAACTGCCAGG + Intergenic
1139735430 16:68983654-68983676 CACTGCCACACTCAACTGCAGGG - Intronic
1141897914 16:86970495-86970517 CACTGACACAACCACCTGCAGGG + Intergenic
1141899936 16:86984577-86984599 CCCTGCCCCCATCAGATGCATGG - Intergenic
1142324125 16:89403036-89403058 CACTGCCTCGCTCAACTGCGTGG + Intronic
1142614613 17:1127149-1127171 CAATGCCCCATTCAGCTGCCAGG + Intronic
1143845195 17:9768494-9768516 GACTGCCCCAAGACACTGCAAGG - Intergenic
1143964282 17:10745605-10745627 CAGTGCCACAATCATCTGAAGGG + Intergenic
1145230698 17:21171410-21171432 CCCTGCCCCAAGCACCAGCATGG - Intronic
1149030615 17:52078762-52078784 GACTGCCCCATTGAGCTGCATGG + Intronic
1150295212 17:64003758-64003780 CACAGCCACATTCAACAGCACGG - Exonic
1151453165 17:74211659-74211681 CACTTTCCCCAGCAACTGCAGGG + Intergenic
1152324723 17:79628895-79628917 CACTGCCCCAAGCAACACGAGGG + Intergenic
1153229679 18:2923987-2924009 CACAGCTTCAAGCAACTGCAAGG + Intronic
1156515544 18:37676379-37676401 CACTGGCCCACTCAGATGCAAGG + Intergenic
1156816848 18:41321663-41321685 CACTGCCCCAATCATCTTTTGGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1161068795 19:2250483-2250505 CACTGCCCCATGCAACTCCCTGG - Intronic
1162235462 19:9305653-9305675 CCCTGCCCCCATGAGCTGCAGGG + Intronic
1163639113 19:18451507-18451529 GACTGTCCCAAGCACCTGCAGGG - Intronic
1167166778 19:47804023-47804045 CTCTGCTCCACTCAACTGCATGG + Intronic
1167175058 19:47859741-47859763 CTCTGCTCCACTCAACTGCATGG - Intergenic
1167424580 19:49423441-49423463 CGCTGCCCCAGCCCACTGCACGG - Exonic
927479145 2:23436880-23436902 CAATGCTCCTAGCAACTGCAAGG - Intronic
931134227 2:59378186-59378208 CACTGTCCCCATCAGCAGCAGGG + Intergenic
932484028 2:72070197-72070219 CTCTGCCCCAGGCAACTGCTGGG + Intergenic
933583958 2:84160125-84160147 CACTGGCCCAACTTACTGCATGG + Intergenic
933936178 2:87205562-87205584 CACTGCCTCAATCAGCTTCAAGG - Intergenic
936356972 2:111760267-111760289 CACTGCCTCAATCAGCTTCAAGG + Intergenic
937295220 2:120806244-120806266 CACAGCCCCCACCAAATGCAGGG - Intronic
940331686 2:152481947-152481969 CACTGCCTCAGTCAACTTTATGG + Intronic
943910151 2:193553937-193553959 CACTGCCGCATTCAACTCCTGGG - Intergenic
947683015 2:232053386-232053408 CACTGCTGACATCAACTGCATGG + Intronic
947786790 2:232829794-232829816 CACTCCCCCATTCACCAGCAAGG - Intronic
948840822 2:240648059-240648081 CTCTGCCCCAAGCCACTGCCTGG - Intergenic
948910807 2:241001755-241001777 CACTGCCCCCATCCACAGCATGG + Intronic
1168919921 20:1523183-1523205 CACTTCTCCCATCAACTGCTGGG + Intergenic
1170856940 20:20065566-20065588 CCCTGGCCAAGTCAACTGCAAGG + Intronic
1173261804 20:41443043-41443065 CACTGCACAAATCACCTTCAAGG + Intronic
1174076735 20:47942658-47942680 CACTGCCCCACTCCCCTGTAGGG - Intergenic
1174085021 20:48001322-48001344 CACTGCTACAATAAACAGCATGG - Intergenic
1174553034 20:51375174-51375196 CACTTCCCCCATCCCCTGCATGG - Intergenic
1175818202 20:61894632-61894654 ATCTGCCCCTATCAACGGCAGGG + Intronic
1182045703 22:27272431-27272453 CACTGCCCCAACCAGCTGTGTGG + Intergenic
1184478628 22:44735006-44735028 CCCTGCCCCACTCTCCTGCAGGG + Exonic
1184808576 22:46812634-46812656 CAATTCCTCAATCAACTTCACGG - Intronic
953056253 3:39389622-39389644 CAGTTCCCCAATGAAATGCAGGG - Intronic
954290771 3:49648871-49648893 CACTGCCCCATTCCTCTGCCTGG + Intronic
961407748 3:126694060-126694082 CATGGCCCCACCCAACTGCAAGG - Intergenic
961471105 3:127113477-127113499 CACAGCCCCATGCACCTGCACGG + Intergenic
962272470 3:133988056-133988078 CACTGCCCCAAGCATCTGAATGG + Intronic
965657588 3:171004967-171004989 CCCTCCCCCAAAAAACTGCAAGG - Intronic
966544416 3:181129314-181129336 CACTGCCTCAAGGAAATGCATGG - Intergenic
967407994 3:189138680-189138702 CCCAGCCACACTCAACTGCAAGG + Intronic
967917600 3:194590365-194590387 CACAGCCCCAAACAGGTGCAGGG - Intronic
978331123 4:107613100-107613122 CACGGCCCCACTCAAATGTAAGG - Intronic
978347786 4:107789199-107789221 CACTGCCACCATCACCTGCATGG + Intergenic
978600034 4:110418233-110418255 GAGTTCGCCAATCAACTGCAAGG - Intronic
979119518 4:116879459-116879481 CCATGCCCCAATCATCTCCAAGG - Intergenic
979355053 4:119693299-119693321 GACTGACCCAATCAGCTGCTGGG + Intergenic
983420127 4:167506640-167506662 CACTGCCGTAAACACCTGCAGGG - Intergenic
985255388 4:188064915-188064937 CACTGCCACCATTAACTGGAGGG - Intergenic
986039637 5:3979415-3979437 CACTGCCCAGATCAACATCATGG + Intergenic
987702933 5:21425200-21425222 CACGGCCCCACTCAACTGCAAGG - Intergenic
993022335 5:82606070-82606092 CACTGCCACCACCAACAGCATGG + Intergenic
995481193 5:112594928-112594950 CACTGCCCAGATCCCCTGCAGGG + Intergenic
998226598 5:140331737-140331759 CACTGCCCCAGTCCACTTGATGG + Intergenic
998416387 5:141949348-141949370 TTCTGCTCCAATCCACTGCAGGG - Intronic
998881991 5:146654172-146654194 CCCTGCCCCACCCAACTCCAAGG + Intronic
1000413665 5:160960736-160960758 CACTGCACCACGCAAATGCAAGG + Intergenic
1001406027 5:171478204-171478226 CACTGCCCCACTTAACTGCAAGG - Intergenic
1003078746 6:3004181-3004203 CACTGGCCATCTCAACTGCAAGG + Intronic
1003084592 6:3051541-3051563 CACTGGCCATCTCAACTGCAAGG - Intergenic
1004104523 6:12653562-12653584 CATGGCCCCAACTAACTGCAAGG + Intergenic
1005334850 6:24785359-24785381 TACTTCCCCAATCAGCTGCAAGG - Intronic
1006831219 6:36969400-36969422 CACTGCCCCATTTCACTGCGAGG + Intronic
1007628089 6:43257804-43257826 CACTGACATGATCAACTGCAGGG - Exonic
1014828675 6:126075950-126075972 CAGGGCCCCAAGGAACTGCAGGG + Intergenic
1018597924 6:165503229-165503251 CACAGCCACAAACAACTTCAAGG + Intronic
1018768163 6:166950326-166950348 CACTGCCCCAACCCAAGGCAAGG + Intronic
1020012820 7:4815818-4815840 GACTTCCCCCATCACCTGCAGGG - Intronic
1020448575 7:8296583-8296605 CACTAATCCAATCAATTGCATGG - Intergenic
1020712509 7:11625912-11625934 CACTGCCCCGATCAGCAGCAAGG + Intronic
1021236853 7:18153137-18153159 CAGTGGCCTAATCAATTGCAAGG + Intronic
1022304533 7:29134307-29134329 GAATCCACCAATCAACTGCAGGG + Intronic
1022355793 7:29613277-29613299 CACTGACCCATTCAGCTGCCTGG - Intergenic
1023762974 7:43483938-43483960 CACTGCCACAATCAGATGGAAGG + Intronic
1024814563 7:53253996-53254018 CACTGACCCAAGGAACTGCAAGG - Intergenic
1029592849 7:101518755-101518777 TGCTGCCCCAAACAACTGCTGGG + Intronic
1030920756 7:115382916-115382938 CACTGATCCAATCAGCTGAATGG - Intergenic
1031636546 7:124108072-124108094 CACCTCCCCAATCAATTGGATGG - Intergenic
1033225787 7:139561066-139561088 CTTAGCCCCACTCAACTGCATGG + Intergenic
1039156509 8:34564517-34564539 CAGCTCCCCAACCAACTGCATGG - Intergenic
1042565081 8:70102902-70102924 CACTGCCCCACTCCACTCCAAGG + Intergenic
1047093099 8:121594977-121594999 CAGGGCCCCAATCCACTGTATGG + Intergenic
1048036456 8:130682038-130682060 CACTGCCCCACCCAACCACAAGG - Intergenic
1048913122 8:139155611-139155633 TTCTGCTCCAGTCAACTGCAAGG + Intergenic
1052237611 9:26231170-26231192 GACTTCTCAAATCAACTGCACGG + Intergenic
1055108747 9:72539005-72539027 AACTCCCCCAATCAACTGAATGG - Intronic
1056312832 9:85358636-85358658 AACTGGCCTCATCAACTGCATGG - Intergenic
1061485055 9:130916299-130916321 CACTGGCAAAATCAACTGAATGG - Intronic
1187313044 X:18165005-18165027 CACTGACCCAAGCACCTGAACGG - Exonic
1188009525 X:25041487-25041509 CATGGCCACACTCAACTGCAAGG - Intergenic
1188782331 X:34301016-34301038 CACTGCCTCCAACAACAGCATGG - Intergenic
1195537168 X:106022126-106022148 CATTGCTCCATTTAACTGCATGG + Intergenic
1196299451 X:114037621-114037643 CAGTGGCCCAGCCAACTGCATGG + Intergenic