ID: 1067710981

View in Genome Browser
Species Human (GRCh38)
Location 10:48651042-48651064
Sequence GGATATAGTGGACCAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067710981_1067710987 17 Left 1067710981 10:48651042-48651064 CCTGGGCTTGGTCCACTATATCC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1067710987 10:48651082-48651104 TACATTACATCACATCACCTGGG No data
1067710981_1067710986 16 Left 1067710981 10:48651042-48651064 CCTGGGCTTGGTCCACTATATCC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1067710986 10:48651081-48651103 TTACATTACATCACATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067710981 Original CRISPR GGATATAGTGGACCAAGCCC AGG (reversed) Intronic
902742165 1:18446161-18446183 GGATATAGTGTATCAAGCAGAGG - Intergenic
906522473 1:46475557-46475579 GGAGATAGTGGAAGGAGCCCTGG + Intergenic
906538028 1:46562732-46562754 TGATGTAGAGGACCACGCCCAGG + Exonic
912493008 1:110072273-110072295 GGATCTAGTGGATCCAGCTCTGG + Intronic
912787010 1:112614190-112614212 TGATATAGTGGAAAAAGCTCTGG - Intronic
913452630 1:119002303-119002325 GCACATAGTGGACCATTCCCAGG - Intergenic
915140309 1:153763862-153763884 GGAAATTGTGGACCAGGTCCTGG + Exonic
915215828 1:154340306-154340328 GAATGTAGTGCCCCAAGCCCAGG + Intronic
915891688 1:159779688-159779710 GGACACAGTGATCCAAGCCCAGG - Intergenic
917471655 1:175330915-175330937 GAATATATTAGACCAAGGCCTGG - Intronic
917865556 1:179190904-179190926 GGATATAATGGACCATATCCTGG - Intronic
920066764 1:203274596-203274618 GGATATACAGGCCCAAGTCCTGG - Intergenic
920576656 1:207065792-207065814 GCATCTAGTGGGCAAAGCCCAGG - Intronic
924639040 1:245816059-245816081 GGATATTTTGGTCAAAGCCCTGG + Intronic
1066586804 10:36944564-36944586 TGATGTAGAGGACCATGCCCAGG + Intergenic
1067710981 10:48651042-48651064 GGATATAGTGGACCAAGCCCAGG - Intronic
1068812425 10:61270845-61270867 GCATCTAGTGGACAAAGACCAGG - Intergenic
1069905575 10:71730392-71730414 GGCCACAGTGGGCCAAGCCCTGG + Intronic
1074161585 10:110840632-110840654 GGCCATGGTGGACCAAGCTCAGG + Intergenic
1074306283 10:112281499-112281521 TGGTATACTGGACCAGGCCCTGG - Intergenic
1079476403 11:20834324-20834346 GGATATAATGGATGAGGCCCAGG + Intronic
1081090151 11:38854719-38854741 TGATATGGTGGACTAAGCCTGGG + Intergenic
1089339975 11:117750666-117750688 GGTTCTAGTGGAACAACCCCTGG + Intronic
1093334040 12:17878888-17878910 TGCTATTGTGGACCAGGCCCAGG - Intergenic
1100682461 12:96942312-96942334 AGGTATAGTGTAACAAGCCCTGG - Intronic
1101530643 12:105570353-105570375 CAATATAGTGGACCAAGCATGGG + Intergenic
1101738255 12:107479916-107479938 GGCTATCCTGGACCAAGTCCTGG - Intronic
1103460187 12:121097546-121097568 GGATGTAGAAGACCAAGGCCTGG + Intergenic
1106533060 13:30612968-30612990 GAATATACTGGAAAAAGCCCTGG + Intronic
1110303422 13:73956469-73956491 GGATATAGTGGCAGAAGCCAAGG - Intronic
1112265856 13:97922633-97922655 TGATATAGTGGAACAGGCTCGGG + Intergenic
1112387034 13:98949351-98949373 TGTAACAGTGGACCAAGCCCAGG - Intronic
1113635181 13:111914532-111914554 GGAGATACTGGACCACCCCCAGG + Intergenic
1114263700 14:21058342-21058364 GGATAAAGTTGTCTAAGCCCTGG + Exonic
1117714229 14:58563959-58563981 GAATTTAGTGGTCCAACCCCTGG - Intergenic
1118669046 14:68102149-68102171 TGGTTTTGTGGACCAAGCCCAGG - Intronic
1120529650 14:85616606-85616628 GGATAGAGAGGCCCAAGCCAGGG - Intronic
1120947054 14:90007666-90007688 GGTTACAGTGAACCAAGCCTGGG - Intronic
1121265659 14:92600837-92600859 GCATCTAGTGGACAGAGCCCGGG - Intronic
1121531298 14:94656092-94656114 GGAGATGGTGAACCATGCCCTGG - Intergenic
1122492866 14:102131603-102131625 GAAAAGAGTGGACCAAGCACAGG - Intronic
1124509109 15:30307044-30307066 TGATTTAGTGGGCCAGGCCCAGG - Intergenic
1125325225 15:38529657-38529679 GGAAAAAGTGGACAAGGCCCAGG - Intronic
1125528529 15:40395277-40395299 GGATCTATTGGACCAGGCCTAGG - Intergenic
1132054416 15:98638485-98638507 GGATAAAGAGCACCAAGTCCAGG - Intergenic
1134035211 16:11024830-11024852 GGATATGGTGTACCACGCGCTGG + Exonic
1137578126 16:49617291-49617313 GGACAGAGGGGACCAAGCTCTGG + Intronic
1143001623 17:3798450-3798472 GGATAGGAGGGACCAAGCCCTGG - Intronic
1143265860 17:5636935-5636957 GGGAATAGTGGTCCAAGCCCTGG + Intergenic
1143419331 17:6776509-6776531 TGATATGGTGGACCAACCCTGGG + Intronic
1148212102 17:45814799-45814821 GGCTGGAGTGGGCCAAGCCCAGG - Intronic
1149032882 17:52103905-52103927 TGATATAGTGAAGCAAGCTCGGG + Intronic
1149134142 17:53344709-53344731 GGACAAAGTGGAACAAGCCAGGG + Intergenic
1155237939 18:23840217-23840239 ATATCTAGTGGACAAAGCCCAGG - Intronic
1156474166 18:37395085-37395107 AGAAATAGTGGTCGAAGCCCAGG - Intronic
1157802975 18:50635890-50635912 GACTATAGTGGACCAGGCCATGG - Intronic
1160095083 18:75863885-75863907 GGATATAGTGTATCAACCACAGG - Intergenic
1163776153 19:19219065-19219087 GGATAAAGTGGACCAAGGTGCGG + Exonic
1168596615 19:57682731-57682753 GGAGATAGTGCAGCCAGCCCAGG + Intronic
926283471 2:11468929-11468951 GGATGTAGTGGCCAAAGTCCTGG - Intergenic
926421688 2:12705962-12705984 GAAGATAGTGCGCCAAGCCCTGG - Intergenic
933752485 2:85611897-85611919 GGATATGGTGCACGAAGCCGTGG + Exonic
937904115 2:127043656-127043678 GGATAAAGTGAACCAAGCAAGGG + Intergenic
941737658 2:168997057-168997079 GACTAAAGTGGACCAAGCCCTGG - Intronic
947996159 2:234529571-234529593 ATATCTAGTTGACCAAGCCCAGG + Intergenic
948510096 2:238458320-238458342 GGATACAAGGGACCAAGCTCAGG - Intergenic
1176196232 20:63837344-63837366 GGACATAGTGGAGCAGGCACGGG + Intergenic
1185195455 22:49466616-49466638 GGACATGGTGGGCCGAGCCCTGG - Intronic
951713147 3:25606783-25606805 GGATATAGTTGGACAACCCCTGG - Intronic
953754644 3:45635876-45635898 GGAGGGAGTTGACCAAGCCCAGG + Intronic
953900548 3:46839231-46839253 TGATATACTGTAGCAAGCCCAGG - Intergenic
954149312 3:48649351-48649373 GGAGGTAGCGGCCCAAGCCCAGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961931442 3:130538104-130538126 TGATATAGTGGAAAAAGCACTGG + Intergenic
964551288 3:157887645-157887667 GGATCTAATGGCCCAAGCCTAGG - Intergenic
978850743 4:113332921-113332943 GGACATAGTGGGCCATCCCCTGG - Intronic
979609452 4:122673779-122673801 GGATATAGTGAAAGAAGCCAAGG + Intergenic
984273212 4:177573621-177573643 GGATATAGTTTCCCAATCCCTGG + Intergenic
988326561 5:29776270-29776292 GGAAAAAGTGGACGAAGCACAGG - Intergenic
995139965 5:108724913-108724935 GCATATAGTGGATAAAGGCCAGG + Intergenic
995147734 5:108806046-108806068 TGGTATTGTGGGCCAAGCCCAGG + Intronic
996520313 5:124418699-124418721 GGATAAAGGTGAACAAGCCCTGG - Intergenic
997810307 5:136961552-136961574 GGAGATAGTAGACAAAGCCTAGG - Intergenic
1000177485 5:158771895-158771917 TGGTATAGTGGACAGAGCCCTGG - Intronic
1006011336 6:31045262-31045284 AGATATAGTGGACCCAGGGCAGG - Intergenic
1008980637 6:57479708-57479730 GGATATAGTGGATAAAGACCTGG + Intronic
1009168743 6:60372664-60372686 GGATATAGTGGATGAAGACCTGG + Intergenic
1014290057 6:119547868-119547890 TGTTATAGTTGCCCAAGCCCTGG - Intergenic
1014886935 6:126793399-126793421 GGATACAGTTGACCAAGTCTAGG - Intergenic
1015195671 6:130522577-130522599 TGATATAGTGGATAAAGCACTGG - Intergenic
1023541416 7:41270741-41270763 GGTTATAGTGTCCCCAGCCCTGG + Intergenic
1026215623 7:68346281-68346303 GAATACAGTGAAACAAGCCCAGG + Intergenic
1037179865 8:15992530-15992552 GGATATAGGGGTCCAAGGACAGG - Intergenic
1037905371 8:22713234-22713256 GGATACAAAGCACCAAGCCCTGG + Exonic
1040721481 8:50329633-50329655 TGATTTTGTGGACCAGGCCCAGG - Intronic
1043345783 8:79296586-79296608 TGGTTTAGTGGACCAGGCCCAGG + Intergenic
1057767102 9:97931091-97931113 GGAAATAGTGGAGAAAGCACTGG - Exonic
1060479404 9:124009188-124009210 GGATCTAGGGGCCCAGGCCCCGG - Intronic
1062037567 9:134389508-134389530 GGATAGAGATGCCCAAGCCCTGG - Intronic
1186819044 X:13267537-13267559 GCATTTAGTGGATCAAGTCCAGG + Intergenic
1187239094 X:17496213-17496235 GGATCTAGGGGAACAGGCCCAGG + Intronic
1189656445 X:43249657-43249679 TGATTTTGTGGACCAGGCCCAGG + Intergenic
1189863622 X:45300178-45300200 GGATAAAGTGAACCAACCTCTGG - Intergenic
1192440244 X:71169073-71169095 GGATATAGGAGTTCAAGCCCTGG + Intronic
1193614525 X:83671406-83671428 TGATTTTGTGGGCCAAGCCCAGG + Intergenic
1196601411 X:117605403-117605425 TGATTTAGTGGGCCAGGCCCAGG + Intergenic
1197869497 X:131051564-131051586 TGATGTAATGGACCGAGCCCTGG + Intergenic