ID: 1067711759

View in Genome Browser
Species Human (GRCh38)
Location 10:48656059-48656081
Sequence CGGCCGCCCGGGGCCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067711746_1067711759 5 Left 1067711746 10:48656031-48656053 CCAGGGCCAGCCGTCTCCTCCCC 0: 1
1: 0
2: 6
3: 53
4: 565
Right 1067711759 10:48656059-48656081 CGGCCGCCCGGGGCCTGCCTGGG 0: 1
1: 0
2: 0
3: 26
4: 271
1067711749_1067711759 -5 Left 1067711749 10:48656041-48656063 CCGTCTCCTCCCCTGCCTCGGCC 0: 1
1: 1
2: 12
3: 169
4: 1652
Right 1067711759 10:48656059-48656081 CGGCCGCCCGGGGCCTGCCTGGG 0: 1
1: 0
2: 0
3: 26
4: 271
1067711747_1067711759 -1 Left 1067711747 10:48656037-48656059 CCAGCCGTCTCCTCCCCTGCCTC 0: 1
1: 0
2: 4
3: 133
4: 1372
Right 1067711759 10:48656059-48656081 CGGCCGCCCGGGGCCTGCCTGGG 0: 1
1: 0
2: 0
3: 26
4: 271
1067711745_1067711759 12 Left 1067711745 10:48656024-48656046 CCTGGAACCAGGGCCAGCCGTCT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1067711759 10:48656059-48656081 CGGCCGCCCGGGGCCTGCCTGGG 0: 1
1: 0
2: 0
3: 26
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067711759 Original CRISPR CGGCCGCCCGGGGCCTGCCT GGG Intronic
900387678 1:2417943-2417965 GTGCCCTCCGGGGCCTGCCTCGG + Intergenic
901022249 1:6261270-6261292 CGGCCGGCCCGAGCCTCCCTGGG + Intergenic
901332713 1:8423570-8423592 CGGCCGCCCGGGACCAGGCTGGG - Intronic
901443531 1:9293304-9293326 CGGCAGCGCGGGGCGGGCCTGGG - Intronic
903220831 1:21868892-21868914 CAGCTGCCCCGGGCCTTCCTGGG - Intronic
903807715 1:26017330-26017352 CAGCTGCCTGGGGGCTGCCTGGG - Intergenic
905205999 1:36343178-36343200 GAGCTGCCTGGGGCCTGCCTTGG - Intronic
905995889 1:42380553-42380575 CGGGTGTCCGGGGCCTGCCGGGG + Intergenic
906214384 1:44030528-44030550 CGGCCGCCCGGCCCCGCCCTAGG + Intronic
907306136 1:53514138-53514160 CGGCCTGCGGGGGGCTGCCTGGG - Intronic
915734721 1:158077536-158077558 CTTCCTCCCTGGGCCTGCCTTGG + Intronic
918048253 1:180954058-180954080 CGGCCGCCCGCTGCCTGCCCTGG - Intergenic
919809472 1:201399568-201399590 CGGACGCCCGGGGCCGGCGTGGG + Exonic
920260569 1:204685378-204685400 CTTCCGCCCGGGGCCGGGCTGGG + Intronic
921930270 1:220748825-220748847 GGGCAGCGCGGAGCCTGCCTGGG + Intronic
922768067 1:228166233-228166255 CGGGCGCCCGGGGCCTGCAGAGG + Intronic
924052541 1:240092830-240092852 CCTCAGCCCGGGGCCTTCCTGGG + Exonic
1062909786 10:1205165-1205187 CTGCTGCCCGGGGGCTGCCTCGG + Intronic
1063257772 10:4347736-4347758 GTGCCCCCCGGGGCCTGTCTGGG + Intergenic
1063381777 10:5590302-5590324 CAGCCACAAGGGGCCTGCCTGGG - Intergenic
1063417910 10:5889243-5889265 GGGCTGCCCGGGGCCGGCCGGGG - Exonic
1063660981 10:8034941-8034963 CGGGCGCCCGGGGAGGGCCTTGG + Intergenic
1063663881 10:8050647-8050669 CGGAGCCCCGGCGCCTGCCTGGG - Intergenic
1064230687 10:13528167-13528189 CGGCCGCCCCAGCCCTGCCCCGG + Intronic
1065390084 10:25174584-25174606 CCGCCGCCCGCGGGCCGCCTCGG + Intergenic
1067211090 10:44260920-44260942 CAGACGCCCTGGGCCTGGCTGGG - Intergenic
1067300192 10:45001000-45001022 GGGGCGCTCGGGGCCTGCGTCGG + Intronic
1067711759 10:48656059-48656081 CGGCCGCCCGGGGCCTGCCTGGG + Intronic
1072591818 10:96833336-96833358 CGGCCGCCCGGCCCCTCCCGGGG - Intronic
1072916661 10:99540967-99540989 TGACCGCCCCGGGCCCGCCTGGG - Intergenic
1072994306 10:100229572-100229594 CGGCGGCCCGGAACCGGCCTTGG - Exonic
1073325824 10:102643675-102643697 CGGGCGCCCGGGCTCTGCCGAGG - Intergenic
1076247834 10:128961487-128961509 TGGCGGCCTGGGTCCTGCCTTGG - Intergenic
1076294929 10:129376783-129376805 GGCACGCCCGGGGCCTGCCCAGG + Intergenic
1076726485 10:132416471-132416493 TGGCCATCCGGGGCCTGCGTGGG + Intronic
1076782472 10:132731824-132731846 CGAACGCCCTGGGCATGCCTCGG - Intronic
1077083058 11:734067-734089 CCTCCTCCCGGGGCCTGCCTAGG - Intergenic
1077282769 11:1753092-1753114 CGTCCTCCCGGGCCCTCCCTTGG - Exonic
1077323442 11:1952950-1952972 CGGCCTCACGGGGGCTCCCTGGG - Intronic
1078057592 11:8019807-8019829 ACTCCGCCCGGGGCCAGCCTCGG - Intronic
1080540330 11:33258126-33258148 CGGCGGCCCAGGGCCTGGCGTGG - Intronic
1083547633 11:63560836-63560858 CAGCTGCCCTGGGCTTGCCTAGG - Intronic
1083583163 11:63838317-63838339 ACGCTGCCCTGGGCCTGCCTGGG + Intergenic
1083657222 11:64235269-64235291 TGGCCACCCGGGACCTGCCCTGG - Intronic
1083956037 11:65983368-65983390 GGGCACCCCTGGGCCTGCCTCGG - Intergenic
1084172127 11:67405802-67405824 CAGCCTCCCTGGGCCTTCCTGGG - Intronic
1084792067 11:71481268-71481290 CAGCCTCCTGGGGCCTGCTTGGG + Intronic
1088223241 11:107591262-107591284 CGGCCGCCCCTGTCCAGCCTCGG + Exonic
1089543608 11:119206120-119206142 CGGCCGGCCGCGGCCGGACTGGG - Exonic
1091026192 11:132143283-132143305 CAGCCTCCCAGGCCCTGCCTGGG + Intronic
1202806430 11_KI270721v1_random:8145-8167 CGGCCTCACGGGGGCTCCCTGGG - Intergenic
1091616266 12:2053185-2053207 GGGGCGCGCGGGGCCCGCCTGGG - Intronic
1096983639 12:55743172-55743194 CGGCCCCCCGGGTCCCCCCTCGG + Intergenic
1097990204 12:65825436-65825458 CGGCCGCCCCGCGCGTGTCTGGG - Intronic
1102149035 12:110676089-110676111 CAGCCGCTCTGGCCCTGCCTGGG - Intronic
1102300423 12:111767153-111767175 CGGCGGCGCGGGGCCTTCCTAGG - Intronic
1102933893 12:116881393-116881415 CAGCCGCCGGGGGCCTCCCCTGG + Exonic
1103722235 12:122981071-122981093 AGCCCGCCCGCGGCCGGCCTTGG + Exonic
1103800289 12:123533553-123533575 GGGCCGGCCGGGCCCAGCCTGGG + Exonic
1103851973 12:123939204-123939226 CCACCACCCAGGGCCTGCCTAGG + Intronic
1104961580 12:132490618-132490640 CGGCCTCCCGGCGCCGGCCACGG - Exonic
1104989738 12:132618851-132618873 CGACCGCCCGGCGCCTGGCCCGG + Exonic
1105202782 13:18194296-18194318 ATGCAGCCCGGGGCCTGCCCAGG - Intergenic
1105281054 13:18962816-18962838 CAGCAGCCTGGGGCCTCCCTGGG + Intergenic
1105290256 13:19048828-19048850 CAGCAGCCTGGGGCCTCCCTGGG + Intergenic
1106570680 13:30924604-30924626 CAGCTGCCCTGGGCCTGCCAGGG - Exonic
1111975935 13:94967712-94967734 CGGCCGCCGGGTGCCTGCTCCGG - Intergenic
1113809551 13:113129988-113130010 CCGCAGCCCGCGTCCTGCCTTGG + Intronic
1113861703 13:113491100-113491122 CGGCCTCCCTGGTCCCGCCTGGG + Exonic
1113902373 13:113804186-113804208 AGGCCGGCCGGGGCCTGAGTTGG + Intronic
1116905174 14:50396922-50396944 CTCCCGCCCCGGGTCTGCCTGGG + Intronic
1118734401 14:68691322-68691344 CGGCAGCCCGGCCCCTGCCCCGG + Intronic
1119261015 14:73238003-73238025 CGGCCACCCCGGGCCTCCCGTGG + Intronic
1119569935 14:75661294-75661316 CGGCTGCCCTGAGCCTTCCTGGG + Exonic
1121664861 14:95664825-95664847 CTGCCAACCGGGGCCTGGCTTGG + Intergenic
1121792555 14:96709994-96710016 CAGCAGCCCGTGTCCTGCCTGGG + Intergenic
1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG + Intronic
1122296983 14:100711335-100711357 AGGCCCCCTGGGACCTGCCTGGG + Intergenic
1122362685 14:101176633-101176655 GGGGAGCCGGGGGCCTGCCTGGG + Intergenic
1122415903 14:101549339-101549361 CGAGCGCCCGGCACCTGCCTGGG + Intergenic
1122693030 14:103540226-103540248 GGGCCCCCTGGGCCCTGCCTTGG - Intergenic
1123011368 14:105351049-105351071 CGGGAGCCCGGGGCCAGCCCAGG - Intronic
1123037798 14:105478516-105478538 CGGCTGCCCTCGGCCTGCCCTGG + Intronic
1123048308 14:105528809-105528831 CGGCCGCCGGGCCCCGGCCTGGG - Exonic
1125608002 15:40953154-40953176 CGCCCGCCCGGTGCCCGCCCTGG + Exonic
1125754549 15:42054133-42054155 GGGCCACCCAGGGCCTGGCTGGG - Intergenic
1127953573 15:63833709-63833731 CGGCCGCGCAGGGCCGGCCGGGG - Intronic
1128058559 15:64718705-64718727 TGGCCGCCCTGGGACTGCGTGGG + Intergenic
1128133969 15:65249306-65249328 CCCCCGCCCAGGGGCTGCCTGGG - Intronic
1128154659 15:65385032-65385054 AGCCGGCCGGGGGCCTGCCTGGG + Exonic
1129483147 15:75843557-75843579 CCGCCCCGCGGGGCCGGCCTGGG - Exonic
1131367676 15:91853761-91853783 CGGCCGCCCCCGTCCTGCCGGGG - Exonic
1132484124 16:181382-181404 CCGCCGCCCGGGGCGTCCCGCGG - Intergenic
1132525092 16:410512-410534 CGGCCGCCCGCTCCCTGCCCTGG + Intronic
1132525106 16:410547-410569 CGGCCGCCCGCTCCCTGCCCTGG + Intronic
1132525121 16:410582-410604 CGGCCGCCCGCTCCCTGCCCCGG + Intronic
1132642258 16:983271-983293 CGGGCGCCTGGGCCCTGCCAGGG + Intronic
1132669854 16:1098098-1098120 GGCCCTCCCGGGGCCCGCCTGGG - Intergenic
1132683943 16:1154429-1154451 CCCCCGCGAGGGGCCTGCCTCGG - Intronic
1132746112 16:1436996-1437018 CGGCTGCCCAGGCCCTGCCTTGG - Intronic
1132760436 16:1506244-1506266 CTGCCTGCCGGGCCCTGCCTCGG - Exonic
1132885706 16:2181131-2181153 CGGCCGGGCCGGGCCTCCCTGGG + Exonic
1132905487 16:2280585-2280607 CCTCTGCCCGGGGCCTGCATGGG - Intronic
1134539916 16:15055986-15056008 CCGCCTCCCTGGGCCTGCCTGGG - Exonic
1138360688 16:56425190-56425212 CGGCTCGCCGGGGCCGGCCTCGG + Exonic
1139528206 16:67529160-67529182 CGGCCGCCAGGGCCTTGCCGTGG - Intronic
1139920164 16:70454742-70454764 GGGCCGCCCGGGTCCTGACAGGG + Intronic
1141275705 16:82585947-82585969 CGGCATCCAGGGGCGTGCCTTGG + Intergenic
1141909361 16:87047997-87048019 CAGGCCCCTGGGGCCTGCCTAGG + Intergenic
1142143338 16:88482339-88482361 ATGCTGCCCTGGGCCTGCCTCGG - Intronic
1142146256 16:88494142-88494164 CGGCTGCCCCGGGGCGGCCTGGG + Intronic
1142240124 16:88941194-88941216 CGGCCGCCTGGGCCATGCCGGGG + Intronic
1142388889 16:89785123-89785145 CAGCCGCCCGGACACTGCCTAGG - Intronic
1142395352 16:89828579-89828601 CGGCCGCCCTGCGCCCGCCGCGG - Exonic
1142406767 16:89894381-89894403 GGGCCGCCCGGGGGCTGTCTGGG - Intronic
1142767875 17:2075847-2075869 CAGCATCCAGGGGCCTGCCTGGG + Intronic
1143516240 17:7420580-7420602 CTGCCGGCCAGGGCCTACCTGGG + Intronic
1143966062 17:10757169-10757191 CGGCAGCCTGGGGCCAGGCTGGG + Intergenic
1144847107 17:18225770-18225792 CGGCGGCCCGGGCCCGGGCTCGG + Intronic
1144873200 17:18382912-18382934 TGGCCGCCCGGACCCTGCCCGGG + Intronic
1146515071 17:33482778-33482800 CGCCCTCTCAGGGCCTGCCTGGG - Intronic
1147440273 17:40443471-40443493 TCGCCGCCCGCCGCCTGCCTGGG + Exonic
1147599015 17:41734386-41734408 CGGGCGCCGGGCTCCTGCCTTGG + Exonic
1147653009 17:42072673-42072695 GGGCCGCCCGGGGGCGGGCTCGG - Intergenic
1148081015 17:44967793-44967815 CGGCCCTCCGGGGCCTCCCGGGG - Exonic
1149646754 17:58246634-58246656 AGGCCGCGCTGGGCCTCCCTGGG - Intronic
1151748041 17:76022119-76022141 TGGCCGCCCGGACCCTGCCCGGG - Intronic
1151959444 17:77397893-77397915 CGCCTGCCTTGGGCCTGCCTTGG + Intronic
1152218889 17:79050012-79050034 CGGGCGCCTGGGGCCTGGGTGGG + Intergenic
1152353863 17:79797567-79797589 CGGCGGGCCGGGGTCTGCCGAGG - Intronic
1152364044 17:79844891-79844913 CCCCTGCCCGGGCCCTGCCTGGG - Intergenic
1152365852 17:79855919-79855941 CGCCCACCCGGTGCCCGCCTTGG + Intergenic
1152472520 17:80498384-80498406 AGGCCGGCCGGGGCGTGCGTGGG + Intergenic
1152552309 17:81035695-81035717 CCGCCGCCCCGGCCCTGCCCGGG - Intronic
1152570728 17:81120170-81120192 CCGCCACCCGGGGTCTGCCCGGG - Intronic
1153219237 18:2847413-2847435 CGGCAGCCGGGGGCCTCCCTTGG + Intronic
1153285691 18:3452278-3452300 CGGCCGGCGGGGCCCAGCCTTGG - Exonic
1153688241 18:7567374-7567396 CCGCCGCCCGGGGCTGGGCTTGG + Exonic
1153886933 18:9475570-9475592 GGGGCGCCCGAGGCCGGCCTGGG + Intronic
1153900755 18:9614887-9614909 CGGCCGGGCGGGGCCTCCCGCGG + Intronic
1154169213 18:12038638-12038660 GGGCCGCCCGGGGGCGGCCTGGG - Intergenic
1155392345 18:25350374-25350396 CGCCCGCCCGCGTCCTGCTTGGG - Intronic
1157609630 18:48948609-48948631 AGGCCGCCTGGCGCCAGCCTCGG + Intronic
1158976710 18:62716477-62716499 CGCCAGCCGGGGGCCGGCCTCGG - Exonic
1160513495 18:79465802-79465824 TGGCCACCCGGAGCCTGTCTCGG - Intronic
1160682382 19:417800-417822 CTGCAGCCCGAGGCCTGGCTGGG + Intronic
1160948060 19:1652485-1652507 CGGCCGGCCGGGGCGCCCCTGGG + Intronic
1160991985 19:1863787-1863809 CGGCCGCCGGGGGCGGGGCTCGG + Intergenic
1161596072 19:5151553-5151575 CGAACGCCCGGGGCATGCCATGG - Exonic
1161898381 19:7099481-7099503 CGGCTTCCAGGGCCCTGCCTCGG - Intergenic
1162909860 19:13842867-13842889 CGGCCGCCCCCGGCCGGTCTCGG - Intergenic
1163552545 19:17973834-17973856 AGGCCGCCCGGGGCCCGGCATGG - Exonic
1163708645 19:18832462-18832484 CGGAAGCCCGGGCCCGGCCTCGG + Intronic
1163768381 19:19176238-19176260 CTGCCTCCCAGGACCTGCCTAGG - Intronic
1163829246 19:19539996-19540018 CTGCCGCCCAGGGCCTGACCTGG - Intronic
1164673081 19:30083914-30083936 AGGCGGCCCGTGGCCAGCCTTGG + Intergenic
1166749827 19:45159466-45159488 CGGCCTCCCTGGGCCAGCCAGGG - Intronic
1166806842 19:45492770-45492792 CGGCCACTAGGAGCCTGCCTGGG - Intronic
1167454546 19:49591483-49591505 CCCCCGCCCGGGGCCTTCCCGGG + Intergenic
1167578454 19:50328864-50328886 CGGCAGCCCGGGGCATGGCTCGG + Exonic
1168075721 19:53980153-53980175 CGGGGGCCCGGAGCCTTCCTAGG + Intronic
1168336286 19:55599416-55599438 CGGCCTCCCGGGGCCGCCCCGGG - Intronic
925132764 2:1505141-1505163 CGGCTGCCCGGGGCCTTCAGAGG + Intronic
927501137 2:23584146-23584168 AGGCCGGCTGGAGCCTGCCTGGG - Intronic
927853353 2:26513445-26513467 GGGCTGCCCGGGGCCTGTCTGGG + Intronic
929452956 2:42048535-42048557 CGGGAGCCGGGGGCCAGCCTGGG - Exonic
929583727 2:43100942-43100964 CGGCCGCCGGGGCCCCCCCTGGG - Intergenic
931671791 2:64654049-64654071 CGGCCGGCCGCGGCCGGCCCCGG - Intronic
933666722 2:84970860-84970882 CGGGCGCCCGTGCCCAGCCTCGG - Intergenic
933808613 2:86018119-86018141 GGGCTGCCCGGGCTCTGCCTGGG - Intergenic
933870786 2:86563395-86563417 CGGCTGCCCGTGACCTGCCTGGG - Intronic
934238632 2:90250583-90250605 CGCCGGCCCTGGCCCTGCCTTGG + Intergenic
934566940 2:95346475-95346497 CGGCCCCCCCGCGCCTGCCCGGG - Intronic
935275773 2:101474299-101474321 CCGCCGCTCGCTGCCTGCCTCGG - Intronic
937340691 2:121088774-121088796 CTGCCTCCCTGAGCCTGCCTGGG + Intergenic
938727710 2:134121572-134121594 CGGCCGCCCGGGGCCAGGCCTGG - Intronic
942458150 2:176151825-176151847 CAGCGGCCCCGGGCCTGGCTCGG + Exonic
942463965 2:176188995-176189017 CGGCCGCGCGGGGGCGGCCGGGG - Exonic
943578904 2:189661686-189661708 GGGCAGCGTGGGGCCTGCCTGGG + Intronic
943624108 2:190180349-190180371 CTCCCCCGCGGGGCCTGCCTTGG - Intronic
945032886 2:205682105-205682127 CGTCCCCCCGGGGTCTCCCTTGG + Intronic
948669901 2:239561653-239561675 TGGCCACCCGGTGCCTTCCTGGG + Intergenic
948738359 2:240025554-240025576 TGGCTGCCCGGCCCCTGCCTGGG + Intergenic
1172359660 20:34303193-34303215 CGGCCGCCCGGCACCCGCCCGGG - Intronic
1173916030 20:46709496-46709518 CGGCCGCCCCAGGCCTGGCAAGG - Exonic
1175189223 20:57199880-57199902 CGGCCCCCAGGGCCCTGCCCAGG + Intronic
1175251875 20:57614869-57614891 AGGCAGCCGGGGGCCTACCTGGG + Exonic
1175545475 20:59775254-59775276 CGGCCGCCCTGGACCTTCCTGGG - Intronic
1175860394 20:62147349-62147371 CGGTGGCCCTGGGCCTGGCTGGG + Intronic
1175863317 20:62161624-62161646 CGGCTGCCCAAGGGCTGCCTTGG - Intronic
1176156995 20:63626959-63626981 GGGCCGCGCCGGGCCTGCTTAGG + Intronic
1176380485 21:6110321-6110343 CGTCCGCCCGGGGCCCGCGCGGG + Intergenic
1176715172 21:10343709-10343731 ATGCAGCCCGGGGCCTGCCCAGG + Intergenic
1179511279 21:41875322-41875344 CTGCCGTCCGGGGCCTGGCAGGG - Intronic
1179742987 21:43427919-43427941 CGTCCGCCCGGGGCCCGCGCGGG - Intergenic
1179788345 21:43741849-43741871 CCCCCGCCCTGGGCCTGTCTCGG + Intronic
1179876618 21:44272129-44272151 CGTCTGCCCAGGGCCTGCCCTGG - Intergenic
1179995540 21:44972375-44972397 CGGGCAGCCGGAGCCTGCCTGGG + Intronic
1180593948 22:16961788-16961810 CGGAGTCCCGGGCCCTGCCTCGG + Intergenic
1180603177 22:17036246-17036268 ATGCGGCCCGGGGCCTGCCCAGG - Intergenic
1180794470 22:18595294-18595316 CTGCCGCCAGGGGGCAGCCTAGG - Intergenic
1181227269 22:21400026-21400048 CTGCCGCCAGGGGGCAGCCTAGG + Intergenic
1181251381 22:21534813-21534835 CTGCCGCCAGGGGGCAGCCTAGG - Intergenic
1181359381 22:22323102-22323124 GGGCAGCCAGGGCCCTGCCTAGG + Intergenic
1182289837 22:29268581-29268603 GGGGCGCGCGGGGCCCGCCTTGG + Intronic
1183560551 22:38569768-38569790 CGGCCGCAGGGGGTCTGCCCAGG - Intronic
1183752495 22:39729640-39729662 CGGCAGTCCGTGGCGTGCCTTGG - Intergenic
1183966845 22:41447251-41447273 CGTCCGCCCTGCACCTGCCTCGG + Intergenic
1184118261 22:42434398-42434420 CCACAGCCCAGGGCCTGCCTGGG - Intergenic
1184127953 22:42500909-42500931 CGGCCGCACGTGGCCTCCCAGGG + Intergenic
1184136743 22:42554225-42554247 CGGCCGCACGTGGCCTCCCAGGG + Intronic
1184402486 22:44282092-44282114 CGGTGGCCTGGGGGCTGCCTCGG + Intronic
1184502558 22:44882804-44882826 CGGCCACCTCGGGGCTGCCTGGG - Exonic
1184763331 22:46557986-46558008 TGGGAGCCCAGGGCCTGCCTGGG - Intergenic
1184925293 22:47632216-47632238 CAGCAGCCCGGGGCCAGCTTTGG + Intergenic
1185330744 22:50251119-50251141 CGGAGGCCTGGGACCTGCCTGGG + Exonic
1185418096 22:50720860-50720882 CGGCGGCCCGGGCCCGGCCAAGG + Intergenic
950420983 3:12899350-12899372 CTGCCCCCCGGCGCCTGCCCAGG - Exonic
952383478 3:32821832-32821854 GGCCAGCCCGGAGCCTGCCTCGG + Intronic
960601476 3:119463285-119463307 CGGCTGTCCTGGACCTGCCTCGG - Intronic
961350744 3:126300435-126300457 CCGACGCTCTGGGCCTGCCTTGG - Intergenic
961684176 3:128618042-128618064 CAGCCGCCCGGGGGTTCCCTAGG + Intergenic
963133207 3:141876927-141876949 TGGGCGTCCGGGGCCGGCCTCGG + Intronic
966696433 3:182793990-182794012 CGGCCGCTCGGCGCCAGCCTCGG - Intronic
966860813 3:184230143-184230165 CGGCCCCCCGGGGCCCCCCGCGG - Intronic
967878586 3:194283013-194283035 CAGCCGCACAGGGCCTGCCTGGG + Intergenic
968457283 4:706107-706129 CGGCCCTCCCGGGCCTGCCAAGG - Intronic
968601937 4:1513585-1513607 CGGAAGCCCGGGCCCTGCCGGGG - Intergenic
968978742 4:3835459-3835481 CTGCAGCCCGAGACCTGCCTGGG + Intergenic
969575399 4:8033540-8033562 CGACCCCATGGGGCCTGCCTCGG - Intronic
976398570 4:84583144-84583166 CTGGCGCCCGGAGCCTGCCCGGG + Exonic
984928402 4:184826131-184826153 CGGCGGGGCGGGGCCTGCCGGGG - Intronic
985665250 5:1178768-1178790 CGTCCGCTCGAGCCCTGCCTGGG + Intergenic
991628959 5:68634745-68634767 CTACAGCCAGGGGCCTGCCTGGG + Intergenic
992320760 5:75611530-75611552 CCCGCGCCCTGGGCCTGCCTGGG + Exonic
998503380 5:142652805-142652827 TGCCCGCCCGGGGCCTGGCGTGG - Intronic
998616962 5:143751554-143751576 CGGCTGCCTGGGGCATCCCTGGG - Intergenic
999767938 5:154755313-154755335 CGCCCGCCCGCCGCCTGCCGCGG + Intronic
1001070242 5:168579396-168579418 AGGCCGGGCGGGGCCGGCCTAGG + Exonic
1002195208 5:177497466-177497488 CGGGCGCCCGGGGCCTGCTGAGG - Intronic
1002645150 5:180649266-180649288 CGGCCGCCCTGGCCCTGACCCGG + Intronic
1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG + Intergenic
1006942081 6:37759133-37759155 CTGCATCCCGGGGCCTACCTCGG + Intergenic
1015880486 6:137866707-137866729 TGCCCGCCCGGGTCCTGTCTGGG + Intergenic
1015965685 6:138693407-138693429 CCACCGCCCGGGGGCTGCCAAGG - Intergenic
1019114883 6:169751872-169751894 CGGCCTCCCTGGGCCAGGCTCGG + Intronic
1019320332 7:412234-412256 CAGCCACCAGAGGCCTGCCTAGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1020106360 7:5423944-5423966 CGGCGGCCGGGGGCCGGGCTGGG - Intronic
1024024165 7:45397385-45397407 CTACCTCCCGGGTCCTGCCTAGG + Intergenic
1026894264 7:74000853-74000875 CGGCCGCCCTGGGGCTGCAGGGG + Intergenic
1029458667 7:100683482-100683504 GGACAGCCTGGGGCCTGCCTCGG + Intronic
1032525655 7:132576978-132577000 CGGCCGGCCGCGGGCTGCCGGGG - Exonic
1032834788 7:135662622-135662644 CCGCTGCCTGGGGCGTGCCTCGG + Intronic
1033477031 7:141701747-141701769 CGGGAGCCCGGGGCCGGCCCTGG + Intronic
1034386644 7:150746022-150746044 TGGCCGGCTGGGGCCTGCCTTGG - Intronic
1034414463 7:150957273-150957295 CGGCCGCTGGGCGCCTACCTGGG + Exonic
1034428003 7:151024546-151024568 GGGACGCCTGAGGCCTGCCTAGG - Intergenic
1034441161 7:151086700-151086722 GCGCCGCCCCGGGCCCGCCTCGG + Intronic
1034951234 7:155298114-155298136 CGCCCGCCCGGGGCCAGCGGCGG - Intronic
1035360662 7:158311190-158311212 TGGCCGCACGGGTCCTGGCTGGG - Intronic
1035658159 8:1327052-1327074 CTGCCTCCAGGGGCCTGCCCGGG - Intergenic
1036097107 8:5736678-5736700 CGGCCGCCCCTGGCTTGCCGTGG + Intergenic
1038267914 8:26050382-26050404 CGCGCGCCCGGGGCCCTCCTCGG + Intergenic
1039531780 8:38269092-38269114 GGGCCGCCCGGGCCCGGCCGTGG + Intronic
1039785528 8:40831468-40831490 CGGCCGCCTGGGGACTGCCACGG - Intronic
1039828037 8:41191505-41191527 CAGCAGCCAGGGGCCTGCCATGG - Intergenic
1041272034 8:56118164-56118186 CGGCCGCCCGAGTCCTGGCAGGG + Intergenic
1045516476 8:102864402-102864424 CGGCCGCCCTTCGCCTGCCGGGG - Exonic
1047782773 8:128123388-128123410 CAGCCTCCCGGGGCCTGGCCTGG - Intergenic
1049235039 8:141508143-141508165 CTGCCGCGCGAGTCCTGCCTGGG - Intergenic
1049407960 8:142460135-142460157 CTGCCCGCCTGGGCCTGCCTTGG + Intronic
1049471389 8:142776495-142776517 CGGCCCCCAGGGCCCTGCTTGGG - Intronic
1049553293 8:143270489-143270511 GGGGCGCCCGTGGGCTGCCTGGG + Intronic
1049989542 9:977945-977967 CGGCCGGCCCGGCCCTGCCCAGG + Intronic
1050113720 9:2242080-2242102 CGGCGGCTCGGGGCTGGCCTTGG - Intergenic
1053164310 9:35833803-35833825 CGGCTGCCAGGGGCCTGCTTGGG - Intronic
1054870697 9:70044861-70044883 CGCCCGCCCCGTTCCTGCCTCGG - Intronic
1057271786 9:93655741-93655763 CAGCAGCCTGGGGCCTCCCTGGG - Intronic
1061349596 9:130053975-130053997 CGGAGGCCCGCGGCCAGCCTAGG - Exonic
1061902714 9:133681145-133681167 CTGCCGCCCTGGTCCTGCCACGG + Intronic
1062275482 9:135728468-135728490 CAGCCACCCACGGCCTGCCTGGG + Intronic
1062365175 9:136204961-136204983 CGGCGGCCCCGGGCCTCGCTCGG + Intronic
1062460668 9:136661359-136661381 CAGCCGCCCTGTGCCTCCCTCGG - Intronic
1062523282 9:136968454-136968476 CGGCCACCAGGTTCCTGCCTGGG + Intergenic
1062526304 9:136979317-136979339 CGGCCCCCTGGGCCCAGCCTGGG + Intronic
1062543520 9:137051915-137051937 TGGCCTCCTGAGGCCTGCCTGGG + Intronic
1062619118 9:137411600-137411622 CGGCCGCCGCTGGCCTGCCATGG - Intronic
1187900790 X:24025426-24025448 GAGCCGCCCGGGGCCCGCCCAGG + Intronic
1187950407 X:24465260-24465282 GGGCCGCCCGCGGCTTCCCTAGG - Intronic
1189346478 X:40245607-40245629 AGGCCCCCCGCTGCCTGCCTCGG + Intergenic
1189491157 X:41472718-41472740 CCGCGGCTCGGGGCCTGCCCTGG - Intronic
1199793830 X:151177453-151177475 CCGCCGCCCGGGATCTGCCCGGG - Intronic
1200063375 X:153493695-153493717 CGGCAGCCCAGGGCCTGGCTAGG - Intronic
1200251388 X:154556103-154556125 CGGCCTGCCGGGCCCTGCCTGGG - Intronic
1200252384 X:154560398-154560420 TGGCCGCCCGGGCCCTGGCACGG - Exonic
1200265383 X:154644018-154644040 TGGCCGCCCGGGCCCTGGCACGG + Intergenic
1200266379 X:154648313-154648335 CGGCCTGCCGGGCCCTGCCTGGG + Intergenic