ID: 1067713853

View in Genome Browser
Species Human (GRCh38)
Location 10:48671908-48671930
Sequence GCTCGTGGACCTGCGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067713853_1067713865 14 Left 1067713853 10:48671908-48671930 CCCAAGCTCGCAGGTCCACGAGC No data
Right 1067713865 10:48671945-48671967 CTCTTCCCGCGCTGCTCCCAGGG No data
1067713853_1067713866 15 Left 1067713853 10:48671908-48671930 CCCAAGCTCGCAGGTCCACGAGC No data
Right 1067713866 10:48671946-48671968 TCTTCCCGCGCTGCTCCCAGGGG No data
1067713853_1067713867 16 Left 1067713853 10:48671908-48671930 CCCAAGCTCGCAGGTCCACGAGC No data
Right 1067713867 10:48671947-48671969 CTTCCCGCGCTGCTCCCAGGGGG No data
1067713853_1067713864 13 Left 1067713853 10:48671908-48671930 CCCAAGCTCGCAGGTCCACGAGC No data
Right 1067713864 10:48671944-48671966 CCTCTTCCCGCGCTGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067713853 Original CRISPR GCTCGTGGACCTGCGAGCTT GGG (reversed) Intergenic
No off target data available for this crispr