ID: 1067714390

View in Genome Browser
Species Human (GRCh38)
Location 10:48678085-48678107
Sequence CAGAGTCTCCACTTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067714390_1067714392 -2 Left 1067714390 10:48678085-48678107 CCTTCCTCAAAGTGGAGACTCTG No data
Right 1067714392 10:48678106-48678128 TGTAGATAGAACCTCATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067714390 Original CRISPR CAGAGTCTCCACTTTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr