ID: 1067714560

View in Genome Browser
Species Human (GRCh38)
Location 10:48679675-48679697
Sequence CAGTTGTTCAAGTTGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067714560_1067714564 0 Left 1067714560 10:48679675-48679697 CCACCTGCCAACTTGAACAACTG No data
Right 1067714564 10:48679698-48679720 GTGTAGACTGCTCTGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067714560 Original CRISPR CAGTTGTTCAAGTTGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr