ID: 1067715084

View in Genome Browser
Species Human (GRCh38)
Location 10:48684764-48684786
Sequence AACTCCAGCAGCTCCGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067715073_1067715084 21 Left 1067715073 10:48684720-48684742 CCAGCCCCAAGGGGCCTTGCTGC No data
Right 1067715084 10:48684764-48684786 AACTCCAGCAGCTCCGTGGTCGG No data
1067715075_1067715084 16 Left 1067715075 10:48684725-48684747 CCCAAGGGGCCTTGCTGCAGAAC No data
Right 1067715084 10:48684764-48684786 AACTCCAGCAGCTCCGTGGTCGG No data
1067715078_1067715084 -6 Left 1067715078 10:48684747-48684769 CCCAAGTCACCCGCCAGAACTCC No data
Right 1067715084 10:48684764-48684786 AACTCCAGCAGCTCCGTGGTCGG No data
1067715077_1067715084 7 Left 1067715077 10:48684734-48684756 CCTTGCTGCAGAACCCAAGTCAC No data
Right 1067715084 10:48684764-48684786 AACTCCAGCAGCTCCGTGGTCGG No data
1067715074_1067715084 17 Left 1067715074 10:48684724-48684746 CCCCAAGGGGCCTTGCTGCAGAA No data
Right 1067715084 10:48684764-48684786 AACTCCAGCAGCTCCGTGGTCGG No data
1067715076_1067715084 15 Left 1067715076 10:48684726-48684748 CCAAGGGGCCTTGCTGCAGAACC No data
Right 1067715084 10:48684764-48684786 AACTCCAGCAGCTCCGTGGTCGG No data
1067715079_1067715084 -7 Left 1067715079 10:48684748-48684770 CCAAGTCACCCGCCAGAACTCCA No data
Right 1067715084 10:48684764-48684786 AACTCCAGCAGCTCCGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067715084 Original CRISPR AACTCCAGCAGCTCCGTGGT CGG Intergenic
No off target data available for this crispr