ID: 1067720237

View in Genome Browser
Species Human (GRCh38)
Location 10:48722589-48722611
Sequence CAGTGGAATGGGAAGTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067720232_1067720237 -1 Left 1067720232 10:48722567-48722589 CCAACATGTCTGTCAGGTTAACC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG No data
1067720231_1067720237 0 Left 1067720231 10:48722566-48722588 CCCAACATGTCTGTCAGGTTAAC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG No data
1067720230_1067720237 1 Left 1067720230 10:48722565-48722587 CCCCAACATGTCTGTCAGGTTAA 0: 1
1: 0
2: 0
3: 14
4: 231
Right 1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG No data
1067720228_1067720237 20 Left 1067720228 10:48722546-48722568 CCTTCTCTTTCTCTGACTTCCCC 0: 1
1: 3
2: 18
3: 175
4: 1589
Right 1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067720237 Original CRISPR CAGTGGAATGGGAAGTTGCA TGG Intronic
No off target data available for this crispr