ID: 1067723071

View in Genome Browser
Species Human (GRCh38)
Location 10:48744175-48744197
Sequence CCTCCCACCCCAAGTGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067723071_1067723077 8 Left 1067723071 10:48744175-48744197 CCCAACCCACTTGGGGTGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 164
Right 1067723077 10:48744206-48744228 AAGAACACAACAGTAACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067723071 Original CRISPR CCTCCCACCCCAAGTGGGTT GGG (reversed) Intronic
902075055 1:13777726-13777748 CCACCCACCTCAGGTGGGCTAGG + Intronic
902365185 1:15968537-15968559 TCCCCCAACCCAAGTGAGTTTGG - Intronic
902556719 1:17251032-17251054 ACTCCCACCCCTGGGGGGTTTGG - Intronic
903424746 1:23245418-23245440 CCTCACACCTCAAGTGAGATTGG + Intergenic
903936926 1:26902109-26902131 CATCCTTCCCCAAGTGAGTTAGG + Intronic
904941452 1:34166838-34166860 CCCCCCACCCCAAGTTGTTCCGG + Intergenic
905258889 1:36703831-36703853 CCTCCCGCCCCTCATGGGTTGGG - Intergenic
906728021 1:48058182-48058204 CCCCCCACCCCAACAGGTTTTGG + Intergenic
907529877 1:55084482-55084504 CCTCCCACCCCAACTGTTTTTGG + Intronic
908393427 1:63703800-63703822 CCCCCCACCCCCAAGGGGTTGGG + Intergenic
912683881 1:111746891-111746913 ACTCCCACATCAAGTGGCTTTGG + Intronic
912961647 1:114201389-114201411 CCTCCCACCCCAACTGCCATGGG + Intergenic
915508693 1:156373674-156373696 TCTCCCACCCCAGGTTTGTTTGG - Intronic
919609078 1:199722705-199722727 CTTCCCACACAAAGTGGGGTGGG + Intergenic
920216353 1:204363702-204363724 CCTCCCAGCCATAGTGGGTCTGG - Intronic
922675768 1:227547969-227547991 CCACCCACCCCAAGAGGCCTAGG + Intergenic
923332790 1:232940983-232941005 CCTCACACCCAAAGTGACTTGGG + Intergenic
1063037758 10:2303774-2303796 ACTCACACACCAAGTGGGTGTGG - Intergenic
1064444875 10:15384302-15384324 CCTCCCAGCCCAGGTGGCTTAGG + Intergenic
1067451231 10:46383328-46383350 CCTCCCACTTCAAGTGGGGCAGG + Intronic
1067586011 10:47476428-47476450 CCTCCCACTTCAAGTGGGGCAGG - Intronic
1067659703 10:48225099-48225121 CCTCCCAGCCCATCTGGCTTAGG - Intronic
1067723071 10:48744175-48744197 CCTCCCACCCCAAGTGGGTTGGG - Intronic
1070145670 10:73771992-73772014 CTTCCAACCCCAACTGGCTTGGG + Exonic
1070290860 10:75112214-75112236 CCTCCCACCCCGGGTGGGGCTGG + Intronic
1070935754 10:80293665-80293687 CCACCCTCCCCAGGTGGGGTTGG - Intergenic
1073058174 10:100715293-100715315 TTCCCCACCCCAAGTGGCTTAGG + Intergenic
1074931836 10:118134608-118134630 CCTCCCACCCCAAATGCTGTTGG - Intergenic
1076447783 10:130529960-130529982 CCTCCCACCCCACTTCGGTATGG - Intergenic
1077334147 11:1996045-1996067 CCCCCCACCCCAAGTGTGGCAGG + Intergenic
1081577761 11:44329900-44329922 CCTGACGCCCCAAGTGGGCTTGG - Intergenic
1083895833 11:65619319-65619341 CCTCCCACCACCAGTGGGGTGGG + Intronic
1088979601 11:114850202-114850224 CTTCCCAACCCAATGGGGTTGGG - Intergenic
1089901414 11:121989838-121989860 CAACCTACCCCAAGTGGGTGGGG + Intergenic
1202817130 11_KI270721v1_random:51227-51249 CCCCCCACCCCAAGTGTGGCAGG + Intergenic
1091798443 12:3310244-3310266 CTGCCCACCCCAAGTGGATGGGG + Intergenic
1092293727 12:7181837-7181859 ACTCCCAACCCTTGTGGGTTGGG + Intergenic
1092448559 12:8581210-8581232 CCTCTCTCCCCAAGTAGTTTGGG + Intergenic
1092957507 12:13563616-13563638 CCTCCCACTCCACGTTGGTCAGG + Exonic
1096677122 12:53231964-53231986 CCTCCCACTCCAGGTGAGTCAGG - Exonic
1097890534 12:64773158-64773180 CCTTCCACCCTCAGTTGGTTTGG - Intergenic
1098128336 12:67322832-67322854 CCTCCCACCCCCAGTCGGCTTGG - Intergenic
1102489012 12:113277624-113277646 CCTCGAACCCCCAGTGGGGTGGG + Intronic
1102848696 12:116217100-116217122 CATCCCAGCACAATTGGGTTAGG - Intronic
1103249197 12:119485525-119485547 CCTCCAACCTCGAGAGGGTTGGG - Intronic
1104572674 12:129938805-129938827 CATCCCACCCCATCTGTGTTAGG + Intergenic
1104843270 12:131834595-131834617 ACTCCCACCCACAGTGGGTAGGG - Intronic
1105404672 13:20123513-20123535 TCCTCCACCCCAAGTGTGTTCGG - Intergenic
1108187686 13:47904600-47904622 CCTCCCAACCCGAATAGGTTCGG - Intergenic
1114537687 14:23433272-23433294 CCTCCTTCCTCAAGAGGGTTAGG + Intronic
1117445322 14:55798689-55798711 CCTGCCACCCCAAAGGGGATGGG - Intergenic
1119266106 14:73264079-73264101 CCTCCCACCCCAAGTGAGGCTGG - Intronic
1119408051 14:74411005-74411027 CCTGCCACACCCAGTGTGTTGGG - Intronic
1120897160 14:89543893-89543915 CCCCCCACCCCCATTGGTTTTGG - Intronic
1121299473 14:92859170-92859192 CCTCCCACCCCAGCTGAGCTGGG + Intergenic
1124066068 15:26345226-26345248 CCTACCAACTCAAGTGGGTTGGG - Intergenic
1129474396 15:75775355-75775377 CCCCTCTCCCCAAGTGGGTGGGG + Intergenic
1130966413 15:88700923-88700945 CCCCCCACCCCAAGAGGTATAGG + Intergenic
1131219600 15:90571286-90571308 CCTCCCAACCCGTTTGGGTTAGG - Intronic
1132028423 15:98421512-98421534 TCTGCCACCCCAAGGGGCTTGGG + Intergenic
1133033351 16:3021923-3021945 CCTCCAACCACAAGGGGGGTGGG + Exonic
1136005713 16:27327322-27327344 CCTGCCACCCGCTGTGGGTTCGG + Intronic
1136411849 16:30082329-30082351 TCTCCCACCCCAAGTCAGTCTGG - Intronic
1137620933 16:49876413-49876435 CCTCCCACCCCCCGTGGCTCTGG - Intergenic
1143048349 17:4101011-4101033 CCTGCCATCCAAAGTGGGTGGGG - Intronic
1143322283 17:6075895-6075917 CCTCCCAGTCCCAGTGGGCTGGG + Intronic
1144641474 17:16939655-16939677 CCTTCCAGCACAAGTGGGGTCGG + Exonic
1144945716 17:18968558-18968580 CCCCCACCCCCCAGTGGGTTTGG - Intronic
1146589449 17:34116046-34116068 TCTCTCACACCAAGTGGTTTGGG - Intronic
1146707972 17:35015666-35015688 CCTCCCATCCCCAGTTGATTTGG - Intronic
1147631050 17:41931878-41931900 CATCCCACCCTAAGGGGATTGGG + Intronic
1148851078 17:50555667-50555689 TGCCCCACCCCAAGGGGGTTGGG - Exonic
1149577902 17:57727080-57727102 CCTCCCACACCAAGTGGCAAGGG + Intergenic
1151716042 17:75831487-75831509 CCTCCCACCCCAGGTGAGGCTGG + Intronic
1151769822 17:76153291-76153313 CACCCCAGCCCAAGGGGGTTTGG - Intronic
1151890393 17:76947906-76947928 CCACCCACCTCGAGTGGGCTCGG + Exonic
1203170719 17_GL000205v2_random:146102-146124 CCTCCCAGAACAAGTGGGTCAGG - Intergenic
1154533792 18:15375853-15375875 CCACCCACCCCTGCTGGGTTAGG + Intergenic
1155286116 18:24290783-24290805 CCTCCCAAATCAAGTGGGTAAGG + Intronic
1155784929 18:29884160-29884182 CCTCCAACCCCAACAGGGTTTGG + Intergenic
1157831592 18:50861375-50861397 ACCCCCATCCCAAATGGGTTAGG + Intergenic
1160050813 18:75431541-75431563 CCTCCCACCCCTGGTGGTTCTGG + Intergenic
1160680258 19:408936-408958 CCCCCCACCCCAAGCGGAGTCGG - Intronic
1161017659 19:1991226-1991248 CCTCCCACCACAAGTGGCCAAGG - Intronic
1161975925 19:7607742-7607764 CCTCCCCCCCAAGGTGGGCTTGG + Intronic
1164594735 19:29525777-29525799 ACTCCCAACCCAAGCGGGTGCGG + Intergenic
1165163397 19:33832102-33832124 CCTCCCCCACCAAGGGGGTGAGG + Intergenic
1165436654 19:35799053-35799075 CCTCCCTCGCCAAGTGGCCTGGG + Intergenic
1166985770 19:46659471-46659493 CCCCCCACCCCAAGCTGGCTCGG - Intronic
1167738919 19:51312294-51312316 CCCCCCACCCCAACTCAGTTCGG - Intronic
1168358728 19:55719845-55719867 CCTCCCACCCCCATTGTGTGTGG - Intronic
926481908 2:13409686-13409708 CTTCCCACCCCAAGGAAGTTAGG + Intergenic
930875610 2:56212077-56212099 ACTCACACCCCAAGTTGGTCTGG + Intronic
931642351 2:64392973-64392995 CCTCCCACTCCAAGTGAGGAGGG + Intergenic
931736620 2:65199945-65199967 CCCCCAACCCCAGGTGGGTCCGG - Intergenic
932715783 2:74100172-74100194 CCTCCCACCCCCAGTGGGGCTGG + Intronic
933280141 2:80323808-80323830 CCACCCACCCCTAGTGGTCTAGG - Intronic
935713523 2:105919545-105919567 CCTTCCACCCCCAAGGGGTTGGG + Intergenic
936451812 2:112639462-112639484 CTGCCCAACCCAAGTTGGTTGGG - Intergenic
937087275 2:119179737-119179759 CCTCACAACACAGGTGGGTTAGG + Intergenic
938101238 2:128499490-128499512 CCTCCCACCCACAGTGTGCTTGG + Intergenic
938244348 2:129765517-129765539 CCTCCCTCCCTAAGGGGCTTGGG - Intergenic
938986478 2:136581260-136581282 CCTCCCACACCATTTTGGTTTGG + Intergenic
941847193 2:170144882-170144904 CCTCCTTCCACAAGTAGGTTTGG - Intergenic
942212409 2:173684732-173684754 CCTCCAAAGCCAAGAGGGTTAGG - Intergenic
948444901 2:238025014-238025036 CCTCCCACACCCCCTGGGTTTGG - Intronic
1169519405 20:6354953-6354975 TCTCCCACCCCAATAAGGTTAGG - Intergenic
1171394842 20:24825387-24825409 CCTCCCACACCTGGTGAGTTAGG + Intergenic
1172069262 20:32244539-32244561 CCTCCCACCTCCAAGGGGTTAGG + Intergenic
1174395282 20:50243297-50243319 CCGCCGACCACAAGCGGGTTGGG - Intergenic
1178430721 21:32516591-32516613 CAGCCCTCCCCAAGTGGGGTAGG - Intergenic
1179505289 21:41835918-41835940 CCTCCCTCCCCCACAGGGTTTGG + Intronic
1180964024 22:19776343-19776365 CCTCCCACCCCCAGTGAGGGAGG - Intronic
1183009913 22:34936467-34936489 TCTCCCACACTAAGTTGGTTAGG - Intergenic
1183684480 22:39353622-39353644 CTTCCCACCCGAACTGGGCTGGG + Intronic
1184877902 22:47286936-47286958 CCTCACACCCAAAGTAGGGTGGG + Intergenic
950012305 3:9732069-9732091 CCGACCTCCCCAAGTGGGGTCGG + Exonic
950515936 3:13465337-13465359 ACAACCACCCCAAGAGGGTTGGG - Intergenic
953477561 3:43218653-43218675 CCTCCCACCCCCAGTTGGCCAGG + Intergenic
954438748 3:50510064-50510086 CCTCCCCCACCAAGGGGGTTGGG + Intergenic
954646942 3:52137438-52137460 CCTCCCATCTCAAGTGGGCATGG + Intronic
961121630 3:124376165-124376187 CCTCCCAACACAAGTAGTTTCGG - Intronic
967100406 3:186211001-186211023 CCTCTCACCCCACGTTGGCTGGG - Intronic
968521347 4:1036071-1036093 CCTCCCACCCCAGGAGGCTCTGG + Intergenic
968589110 4:1448950-1448972 CCTGCAACCCCAGGTGGGATAGG - Intergenic
968704954 4:2073410-2073432 CCTCCCAGCCCCAGTGGCTCTGG - Intronic
969644762 4:8421322-8421344 GCTCCCAACCCAAAAGGGTTGGG - Intronic
972939412 4:44179009-44179031 TCTCCAACTCCAAGTGGGTGAGG + Intronic
973930578 4:55789559-55789581 CCTGACATCCCTAGTGGGTTGGG + Intergenic
980130653 4:128812606-128812628 TTTCCCACCCCAAGCGGGTGGGG + Intronic
985578692 5:685500-685522 CCTCCCACCCCATGAGCCTTAGG - Intronic
990746516 5:58964333-58964355 CATCCCACCCCAAGATGGCTTGG - Intergenic
992011458 5:72531849-72531871 CCTGCCACTTGAAGTGGGTTTGG + Intergenic
994894744 5:105688409-105688431 CCCCCCACCCCTAGTGGCTATGG + Intergenic
996647885 5:125839331-125839353 CATCACACCCCAAGTCAGTTTGG + Intergenic
1001768180 5:174271512-174271534 CCTCCCAGCCCAGCTGGGGTGGG + Intergenic
1001768181 5:174271515-174271537 CCACCCACCCCAGCTGGGCTGGG - Intergenic
1002967255 6:1978571-1978593 CCTCCCACCCCATGTTCTTTGGG + Intronic
1006342116 6:33452636-33452658 CCCCCCTCCCCCAGTGTGTTGGG + Exonic
1007224233 6:40301754-40301776 CCACCCATCCCAATTTGGTTAGG + Intergenic
1007299109 6:40852982-40853004 CCACCCAGCCCAAGTGGCTGAGG + Intergenic
1007789763 6:44302289-44302311 CCTAGCACTCCAATTGGGTTGGG - Intronic
1007971034 6:46052608-46052630 CCTCCCACCCACTGTGGGATGGG - Intronic
1009301401 6:62027610-62027632 CCTCCCACTCCTAGGAGGTTAGG - Intronic
1017724707 6:157268797-157268819 CCTTGCACCCCAAGTGTGTGAGG + Intergenic
1017759168 6:157554964-157554986 CCTGCCACCCGAAGTGGGAGTGG + Intronic
1019619155 7:1981289-1981311 CCTCCCACCCTAGGTGTGTAGGG - Intronic
1022107040 7:27204126-27204148 TCTCCCACCCTAGGTGGGCTGGG + Intergenic
1022111689 7:27236008-27236030 TCCCCCTTCCCAAGTGGGTTGGG - Intergenic
1025022516 7:55490582-55490604 CCTCCCATGCCAAGTGGGGCAGG + Intronic
1026631542 7:72042189-72042211 CCACCCACCTAACGTGGGTTAGG - Intronic
1029205503 7:98867354-98867376 CCTCCCAGCCAAAGTGGGGAGGG - Intronic
1029576098 7:101404432-101404454 CCTCCCCCCCCAAATGGCTTTGG + Intronic
1029745733 7:102514809-102514831 CCTCCCACACCAAGTGGCCTTGG - Intronic
1029763671 7:102613788-102613810 CCTCCCACACCAAGTGGCCTTGG - Intronic
1035476736 7:159149228-159149250 CCTCCCACCCCAGGCAGGTGGGG + Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1041647250 8:60265484-60265506 CCTCCCTCCCCAAGTGGCTTGGG + Intronic
1041735918 8:61110161-61110183 CCTCCCACCACCAGTGGGGTCGG + Intronic
1043191221 8:77225380-77225402 CCTTTCACCCCCAGTTGGTTTGG + Intergenic
1048345564 8:133572147-133572169 CCGCCCACCCCAACTTGGCTCGG + Intergenic
1051402022 9:16693335-16693357 CTGCCCACCCCCAGAGGGTTGGG - Intronic
1051688279 9:19681536-19681558 CCCCACACCTCAACTGGGTTAGG - Intronic
1059985297 9:119815137-119815159 CCCCCCAACCCTACTGGGTTGGG - Intergenic
1061039002 9:128128799-128128821 CGACCCGCCCCGAGTGGGTTTGG + Intergenic
1061678648 9:132231850-132231872 CCTCCCACCCCAAGAGAGGCAGG - Intronic
1061679865 9:132237682-132237704 CCTCCCTCCCCAAGGGAGCTGGG + Intronic
1062051713 9:134450670-134450692 CCACCCAGCCCAAGTGGACTAGG - Intergenic
1062345244 9:136111381-136111403 CCTCCCACTGCAAGTGGCCTCGG - Intergenic
1062530068 9:136995837-136995859 CCTCCCACTGCCAGTGGGATTGG + Intronic
1062629076 9:137455551-137455573 CCTCCCACCCCAAATAGGTTTGG - Intronic
1185881517 X:3745549-3745571 CCTCCCAGCCCAAATGGACTAGG - Intergenic
1186685715 X:11922672-11922694 CCTGCCACCTCAAGTGGCTGTGG - Intergenic
1189231431 X:39455103-39455125 CCTCCCTTCTCAAGTGGATTTGG + Intergenic
1189854968 X:45214738-45214760 ACTTCCACCCCAAGTTGGCTTGG - Intergenic
1191900954 X:66040191-66040213 CCTCCAACCCCAAGGAGGTGGGG - Intergenic
1192479138 X:71469643-71469665 CCTCCCACCTCAAGTGTCTCCGG + Intronic
1198082740 X:133254439-133254461 CCTCCAAACCCAAGAGGCTTGGG + Intergenic
1198405823 X:136311431-136311453 GCTCACACCCCAAGTGGAGTAGG + Intronic
1200075282 X:153547645-153547667 CCACCCACCCCAAGAGGGCCTGG + Intronic