ID: 1067723130

View in Genome Browser
Species Human (GRCh38)
Location 10:48744925-48744947
Sequence GTGCTGAAGCAGAAAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 372}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067723130 Original CRISPR GTGCTGAAGCAGAAAAAGCA AGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
901491088 1:9596721-9596743 GTGCAGAAGAAAAAAAAGAATGG + Intronic
902443283 1:16445280-16445302 GTGCTGAAGCTGAGAAAGCCTGG - Intronic
904452339 1:30621865-30621887 TTTCTGAAGCAGAACATGCACGG + Intergenic
904545385 1:31266563-31266585 GTGCTGAATGAGAAACAGAAGGG - Intronic
905954671 1:41982293-41982315 GTGCGGAAGAAGAAAATGGAAGG - Intronic
907203382 1:52747455-52747477 ATGGTGTAGCAGAAAAAGTATGG + Intronic
908407402 1:63828836-63828858 GTGCTGAAGCAGGAGTAGCCTGG - Intronic
908844779 1:68313502-68313524 TTGCTAAAGTAGAAAAAGCATGG - Intergenic
909365278 1:74813379-74813401 ATGCTGAAGCTGAAATAGCTGGG - Intergenic
910064244 1:83134375-83134397 GTGCTGGAGTAGAAAAAAGAAGG + Intergenic
912324059 1:108741129-108741151 ATGCTAAAGTACAAAAAGCATGG + Intronic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
913197235 1:116467450-116467472 TTGCTTGAGGAGAAAAAGCAGGG + Intergenic
913199931 1:116487697-116487719 GTGCTGTAGCAGCAACAGAATGG - Intergenic
913663090 1:121021765-121021787 GTGGAAAAGCAGGAAAAGCAGGG + Intergenic
914014473 1:143805030-143805052 GTGGAAAAGCAGGAAAAGCAGGG + Intergenic
914163348 1:145156171-145156193 GTGGAAAAGCAGGAAAAGCAGGG - Intergenic
914653097 1:149713587-149713609 GTGGAAAAGCAGGAAAAGCAGGG + Intergenic
915939544 1:160110045-160110067 GCGCTGAGGCAGAAATAGCCTGG + Intergenic
916392432 1:164345079-164345101 GGGCTGGAACAGAAACAGCAGGG - Intergenic
916537800 1:165720531-165720553 GTGCTGCAGTAGAAAGAGCGTGG + Intergenic
916556748 1:165900018-165900040 GTGAGGAAGGAAAAAAAGCAAGG - Intronic
916570372 1:166020318-166020340 GTGGTACAGCAGGAAAAGCAAGG - Intergenic
917473241 1:175344000-175344022 GGAATGAAGCAGAGAAAGCAGGG + Intronic
918672959 1:187243401-187243423 GTGCCGTAGCAGAAATAACAGGG - Intergenic
919086960 1:192931989-192932011 CTGCAGAAGCTGAAAAGGCAAGG - Intergenic
919694142 1:200556380-200556402 GAGCTGAAACATAAAAGGCATGG - Intronic
919784016 1:201246712-201246734 TTGCTGAAGAAGGAAAAGGAGGG + Intergenic
921001950 1:211053152-211053174 GTGCTGAAGTTGAAAAAACAAGG - Intronic
922655387 1:227377930-227377952 GTTTTGAAGCAGAAGAAGAAAGG - Intergenic
923099501 1:230801110-230801132 GAGCTGAAGGAGAAGTAGCATGG - Intronic
923904792 1:238371918-238371940 CTGCTGAACCTGAAAAAGCAAGG + Intergenic
924611395 1:245576621-245576643 GTCATGAAGCAGAAAAGGCCTGG - Intronic
924816496 1:247446473-247446495 GTACTGGGGCAGAATAAGCAAGG - Intronic
1063246090 10:4220281-4220303 ATGCTGGGGCAGAAAAAGGAAGG - Intergenic
1063746852 10:8893551-8893573 GAGCTGAAGGAGAAAAATCATGG + Intergenic
1064312543 10:14224310-14224332 GTGCTGCAGAAGAACAAGGATGG - Intronic
1064639062 10:17397161-17397183 GAGCTGAAGGAGAAAAAGGTTGG - Intronic
1065966010 10:30770845-30770867 GGGATGAAGCAGAAGAAGTATGG - Intergenic
1067160077 10:43818487-43818509 TTGCTGAAAAACAAAAAGCACGG - Intergenic
1067363579 10:45604187-45604209 GTCCTGAAACAGAAAAGGGAAGG - Intergenic
1067723130 10:48744925-48744947 GTGCTGAAGCAGAAAAAGCAAGG - Intronic
1068000929 10:51333166-51333188 TGGCTGAAGCAGAAATAGCTTGG + Intronic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1068975443 10:63003947-63003969 GGGCTGGAGCAGCAAAAGAAAGG + Intergenic
1069229910 10:65996322-65996344 GTGGTGTAGCAGGCAAAGCAAGG - Intronic
1069850939 10:71404630-71404652 GTGCTGGAGCGGGAAGAGCAGGG - Intronic
1070471546 10:76785336-76785358 GTCCTGAAACAGAAAAGGCCAGG + Intergenic
1070529205 10:77321770-77321792 TTACTGAAGCAGAAAGAACATGG - Intronic
1071800704 10:89056617-89056639 GTACTGAATCAGAAAAGGCATGG - Intergenic
1072525487 10:96267490-96267512 GAACTGAACCAGAAAAATCAAGG + Intronic
1073821911 10:107273840-107273862 ATGTGGTAGCAGAAAAAGCAAGG + Intergenic
1074445856 10:113520439-113520461 GAGCTCAGGGAGAAAAAGCAGGG + Intergenic
1074685405 10:115958022-115958044 GTGCTGACTCAGAAAAAAGAAGG + Intergenic
1074806303 10:117056443-117056465 GGGCTGAAGGAGAAAATTCATGG + Intronic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075578699 10:123599631-123599653 GTGCTGAAGCTGACCAAGTACGG - Intergenic
1075939251 10:126374756-126374778 GTGATGAAGCAAAAACGGCAAGG + Intronic
1076459338 10:130629144-130629166 GTGCTTATAAAGAAAAAGCAAGG + Intergenic
1079564068 11:21859150-21859172 GTAGTGTATCAGAAAAAGCAAGG + Intergenic
1079625811 11:22616563-22616585 GTGCTGAAGAAAAAAAAAAAAGG - Intergenic
1079955050 11:26851978-26852000 GTGCCGAAGAAGAAAAAGGAAGG + Intergenic
1081256901 11:40908043-40908065 GCACTGCATCAGAAAAAGCAAGG + Intronic
1081465065 11:43308892-43308914 TTTCTGAAGCAGAAAAGGCCTGG - Intergenic
1081747802 11:45485232-45485254 GTTTTGAAGCAAACAAAGCAGGG + Intergenic
1083569752 11:63752669-63752691 GTGGTAAAACAGAAAAAGCAGGG + Intronic
1083853900 11:65382727-65382749 TGGCTGCAGCAGAGAAAGCAAGG - Intronic
1086047963 11:82555154-82555176 GTGTTGCTGCAGAAAGAGCATGG + Intergenic
1087045582 11:93841338-93841360 GGAATGAAGCAGCAAAAGCAGGG - Intronic
1087502973 11:98983128-98983150 GAGCTCAAGCAGCAAAAACAAGG + Intergenic
1087757191 11:102066963-102066985 GTGCTGAAGCAGGAAAGTCCTGG + Intronic
1087834122 11:102853524-102853546 GTGCTATAGTAGAAAAAGCATGG + Intergenic
1088297218 11:108312752-108312774 GTGCTATGGCAGAAAATGCATGG - Intronic
1088991257 11:114955456-114955478 GTACTTAAACAGAAAAAGGAGGG - Intergenic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089535165 11:119156544-119156566 GAGCTGCAGCAGAAAGAGAAGGG - Exonic
1090224683 11:125063057-125063079 GTGGTGAGGCAGAAAGTGCAGGG + Intronic
1090501821 11:127268342-127268364 GTGCTGAAATCGAAATAGCAGGG + Intergenic
1091795040 12:3293322-3293344 GTGCTGAAGCAGGAAAAGGGAGG + Intergenic
1091924009 12:4329102-4329124 ATGATTAAGTAGAAAAAGCAGGG - Intronic
1093000495 12:13990628-13990650 GTGCTGAAGCAGAAAAATGCAGG - Intergenic
1093367371 12:18320526-18320548 GTGGTGAAGCTGAAAAATGAAGG + Intronic
1094233454 12:28135897-28135919 GAGGTGAAGCAGAAAAGTCATGG - Intronic
1096198188 12:49662631-49662653 TGGCAGAACCAGAAAAAGCATGG + Intronic
1098513114 12:71342189-71342211 GTGTTTAAGGAGAAAAAACAGGG - Intronic
1100083336 12:90878481-90878503 GTGCTGGGGGAGAGAAAGCAGGG - Intergenic
1100509752 12:95258057-95258079 ATGCTATAGCAGAAAGAGCATGG - Intronic
1101053417 12:100887589-100887611 GTACTAAAGCAGCAAAGGCAAGG - Intronic
1101492488 12:105222426-105222448 TTCCTGAGGCAGAAACAGCAGGG + Intronic
1101544955 12:105703851-105703873 GTGCTGCAGCAGAGAAGGCAGGG + Intergenic
1102342034 12:112129163-112129185 ATGCTGAACCAGAAAAAGGGTGG + Intronic
1102383656 12:112488416-112488438 GGGCAGAAGGACAAAAAGCAGGG - Intronic
1102764678 12:115422479-115422501 TGGCTGGAGCAGAGAAAGCAGGG - Intergenic
1103138675 12:118529726-118529748 TTGTTGAAGAAGAAAAAGAAGGG - Intergenic
1104753168 12:131252712-131252734 CTGCTGAAGGAGATAGAGCATGG - Intergenic
1105672263 13:22632494-22632516 AAGCTTAAGCAAAAAAAGCATGG - Intergenic
1105723171 13:23135712-23135734 ATGCTGCAGCAGAATAAACAAGG + Intergenic
1106609151 13:31262052-31262074 GTGGGGAAGGAGACAAAGCATGG + Intronic
1106899854 13:34344025-34344047 GCTCTGAGGCAGAAAAAACAGGG + Intergenic
1107698521 13:43023772-43023794 GGGCTGAAGCAGAAACTACAAGG - Intronic
1108161393 13:47644113-47644135 ATTCTGAAGCAGAAAAATCAAGG - Intergenic
1108336555 13:49447870-49447892 GTTCTGAAGCAGGAAAAATATGG - Intronic
1108336561 13:49448044-49448066 GTTCTGAAGCAGGAAAAATATGG - Intronic
1108433043 13:50373780-50373802 GTGCTGAAGTTGAGAAATCATGG + Intronic
1108639431 13:52369319-52369341 ATTCTGAATCAGAAAAAGAAGGG + Intergenic
1109634862 13:65102029-65102051 GTTATAAAGCAGAAGAAGCAGGG + Intergenic
1114344526 14:21781113-21781135 GTGTGGACCCAGAAAAAGCACGG - Intergenic
1115841666 14:37478346-37478368 TTGCAGAAACAGAAAAAGAATGG + Intronic
1116886028 14:50222703-50222725 GGGCAGAAGCAGAACAAACAAGG + Intronic
1117475429 14:56089850-56089872 GTGCTGTTGCAGAAAGAGCTTGG + Intergenic
1119691337 14:76675066-76675088 GAGCTGAAGGAGAAACAGCTAGG + Intergenic
1119800162 14:77437152-77437174 GTACTGAACCTGAAGAAGCAAGG + Intronic
1120410325 14:84145912-84145934 GTGCTGAGGCAGAGACAGAAAGG + Intergenic
1120537328 14:85713110-85713132 ATACTGAAGCAGATAAAACAAGG - Intergenic
1121021093 14:90580602-90580624 GTGCAGAAGCAGCACTAGCAAGG - Intronic
1121685360 14:95831525-95831547 GGCCTGAAACAGAAAGAGCAGGG - Intergenic
1122317440 14:100834554-100834576 CAACAGAAGCAGAAAAAGCAGGG - Intergenic
1123412949 15:20074219-20074241 GTGCTGGAGCAGGACACGCAGGG - Intergenic
1123522291 15:21081332-21081354 GTGCTGGAGCAGGACACGCAGGG - Intergenic
1123631482 15:22263107-22263129 ATGCTGAAACACAAACAGCAGGG - Intergenic
1123695793 15:22878236-22878258 ATGCTGAAGAAGAAGGAGCAAGG + Intronic
1124479503 15:30065781-30065803 CTGCTGCAGAAGAAAAAGCAAGG - Intergenic
1125000154 15:34761169-34761191 ATGCTGAAGCACAAAATCCATGG - Intergenic
1125581121 15:40786550-40786572 GAGCTGAAGCAGCCACAGCAAGG + Intronic
1126174352 15:45721767-45721789 GTGGTGAAGTAGACAAAGAAGGG + Intergenic
1127543528 15:59967149-59967171 AGGCTGAAACAGAAACAGCAGGG - Intergenic
1127555182 15:60080759-60080781 TTCTGGAAGCAGAAAAAGCATGG - Intergenic
1129134621 15:73536241-73536263 GTGCTGAGGCAGAAAAATTGAGG - Intronic
1130086230 15:80780089-80780111 GTGCTGAGGCAGGAGCAGCAGGG - Intronic
1130266959 15:82414691-82414713 GCTCTGCAGCAGAAAACGCATGG - Intergenic
1130675780 15:85950718-85950740 ATGCTGAAGCAGGAAAGGCCTGG - Intergenic
1130884634 15:88082821-88082843 GAGCTGAATCAGATAAATCAGGG - Intronic
1130923002 15:88364814-88364836 TTTCTGAAGAAGAAAAATCAAGG + Intergenic
1132390003 15:101431647-101431669 TTGCAGGTGCAGAAAAAGCAAGG - Intronic
1132816545 16:1831341-1831363 GTAATGAAGCAGAAAGGGCAGGG + Intronic
1133202675 16:4213833-4213855 CCTCTGAGGCAGAAAAAGCAAGG + Intronic
1133341552 16:5039805-5039827 GTGAAGACCCAGAAAAAGCAAGG + Intronic
1134091547 16:11394110-11394132 GGGCTGTAGCAGAAACACCAGGG - Intronic
1134103959 16:11471979-11472001 GTGCTGAGGCAGAGAAACCCTGG - Intronic
1134300086 16:12983140-12983162 CTGCTGAGGCAGGAAAAGCCAGG + Intronic
1135402190 16:22173671-22173693 GTTCTGAAGCTTAGAAAGCAAGG - Intronic
1137887396 16:52120172-52120194 GTGCTGAAGAAAAAAAAAAAAGG + Intergenic
1137905860 16:52321290-52321312 GTGCTGAAGGTGGAGAAGCAGGG + Intergenic
1139528824 16:67531651-67531673 TTGCTGGAACAGAGAAAGCAGGG + Intronic
1140108861 16:71985942-71985964 TTGCTGCTGCTGAAAAAGCAGGG + Intronic
1140476794 16:75242987-75243009 GTGCTGGAGCAGGACACGCAGGG - Exonic
1142059765 16:88021578-88021600 TTGCTGAAACGTAAAAAGCATGG + Intronic
1142540551 17:655401-655423 CTGCTGAGGCAGAAGCAGCAGGG + Intronic
1146481603 17:33209417-33209439 GTGCTGAGACTGAAAAACCATGG - Intronic
1146590959 17:34127670-34127692 GTCCTGCAGCAGGAAGAGCAGGG - Intronic
1146959146 17:36957880-36957902 GTGCTGAAGCTACAAAGGCATGG - Intronic
1149571477 17:57675321-57675343 GTGATGGAGCAGAAGGAGCATGG + Intronic
1203161858 17_GL000205v2_random:59968-59990 GTGCTAAACCAGCAGAAGCAAGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1156071259 18:33213212-33213234 CTGCTGAATCAGAAAAAGGCAGG - Intronic
1156112872 18:33748450-33748472 GTACTGAAGCACCAAAATCATGG - Exonic
1156606401 18:38672029-38672051 ATGCTGAAGGAGAGAAGGCAGGG - Intergenic
1157440689 18:47709282-47709304 GTGTTGCAGCAGGAAAAGAAAGG + Intergenic
1158368408 18:56767858-56767880 ATACTGTTGCAGAAAAAGCACGG - Intronic
1160156745 18:76440798-76440820 GGTCTGAAGCAGAAAAAGAAGGG + Intronic
1161993705 19:7699516-7699538 GTGTTGAATCAGAAAAAGGAGGG + Intronic
1162399444 19:10435947-10435969 GTCTTGAAACAGAAACAGCAGGG + Intronic
1164511897 19:28904328-28904350 ATGCTGAAGCTGGAAAACCAGGG - Intergenic
1164768883 19:30792762-30792784 GTTCAGAAGCAGTAAGAGCATGG - Intergenic
1165976237 19:39679198-39679220 GTGCTGCAGCAGAAACGACACGG - Intergenic
1166100236 19:40567565-40567587 GTGATGAGGCAGAAAAACCCAGG + Intronic
1166795321 19:45422285-45422307 GGGCTGGAGTAGAGAAAGCAAGG - Intronic
1167566816 19:50261927-50261949 GTGCTAAAACAGAGAAAGCCCGG + Intronic
925039063 2:716319-716341 GTGCTGAAGCTGTGAAAGCTGGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
927017989 2:18987253-18987275 GTGGTGCAGTAGAAAAAGCATGG - Intergenic
929230140 2:39550675-39550697 GTCCTAAAGCAGGAAAAACAAGG - Intergenic
932319509 2:70811428-70811450 GTGCTGAGGCAGAACAGGCAGGG - Intronic
932757166 2:74416969-74416991 ATGCTGCAGCAGAGAGAGCAAGG - Intronic
933356249 2:81212427-81212449 GTGCTGAAACAGAAAATATATGG - Intergenic
933791407 2:85886808-85886830 CTGCTGAGGAAGGAAAAGCAAGG - Intronic
936831373 2:116652413-116652435 ATGCTTAAGCAGAACAAGAATGG + Intergenic
937246390 2:120496807-120496829 GGGCTGAAGCAGAAGGAGAAGGG - Intergenic
937371503 2:121300984-121301006 GGGAGGAAGCAGAAAAGGCAAGG - Intergenic
938702661 2:133893229-133893251 TTGCTGAAGCAGAACAAGGGAGG - Intergenic
939121812 2:138126485-138126507 GGGCTGACACAGAACAAGCATGG - Intergenic
940074501 2:149726065-149726087 ATGGTGTAGCAGAAAAAGAAGGG + Intergenic
940855862 2:158728378-158728400 GCTCTGAAGCAGAATAAGCCAGG + Intergenic
941439873 2:165521680-165521702 GTGCTGAAGTTGAAAAACCTTGG - Intronic
941442685 2:165557579-165557601 GTGCTGGAGGAGAAAGAGGAGGG + Intronic
941760199 2:169233863-169233885 AAACTGAAGCACAAAAAGCAAGG + Intronic
942308621 2:174633237-174633259 GTGATGAAAGAGAAAAATCATGG - Intronic
942314468 2:174684541-174684563 GTACAGAAGCAGAGAAAGCCGGG - Intergenic
942504461 2:176626905-176626927 GGGCTGAAGCAGAAAGAGCAAGG - Intergenic
942585528 2:177472010-177472032 GTGCTGAAGCAAAATAACCCAGG - Intronic
942920430 2:181366517-181366539 GTGGTGAAGCAAAAAAGGAATGG + Intergenic
943427731 2:187757928-187757950 TTGATCAAGCAGAAAAAGAAAGG - Intergenic
944375737 2:199039400-199039422 GTTCTGAAAAGGAAAAAGCAGGG - Intergenic
944419937 2:199518972-199518994 GTGCAAAAGGAGACAAAGCAAGG - Intergenic
945662666 2:212705835-212705857 GTGATGAAGCAGAATAATAAGGG - Intergenic
946664830 2:222037572-222037594 GTCCTGAGGCAGAAACAGCAAGG - Intergenic
946997847 2:225416014-225416036 GTGCTCAGGCAGAGAAAACAAGG + Intronic
947387324 2:229604515-229604537 GTGCAAGAGCAGAAAAATCAGGG + Intronic
948077419 2:235176079-235176101 GTGCTGAAACAAATTAAGCAGGG + Intergenic
948307230 2:236957339-236957361 GAGCTGAAGCAGACAAAACTGGG - Intergenic
948660160 2:239501973-239501995 GTGCTGGAGCAGAAGGAGCTGGG - Intergenic
1169933674 20:10860052-10860074 GTGCTCAAGCTGAAAAAACTTGG + Intergenic
1170774337 20:19362720-19362742 TGGCTGAAGTAGAAACAGCAGGG - Intronic
1170984004 20:21241856-21241878 AAGCTGAAGCAGAAAAAAAAAGG - Intronic
1172512230 20:35508745-35508767 CTCCTGAAGCAGAAGAGGCAGGG - Intronic
1173120087 20:40280959-40280981 ATGCTGTAGCAGTAAAAGCAAGG - Intergenic
1173454384 20:43190967-43190989 GTGCTGACACAGAAGAAGGAGGG - Intergenic
1173678979 20:44862719-44862741 GTGAAGAAACAGAAAAGGCATGG - Intergenic
1173848893 20:46205492-46205514 GTGGTGCAGCAGAAACTGCAAGG - Intronic
1173986060 20:47262420-47262442 CTGGTGAAGCTGAAAAAGTATGG + Exonic
1174528335 20:51191337-51191359 GTGCTATAGCAGAAAAAGCAAGG - Intergenic
1175660433 20:60808020-60808042 CTGCGGAAGCAGACATAGCATGG + Intergenic
1176043842 20:63082441-63082463 GTGCTGAAGCCCAGAGAGCAAGG - Intergenic
1176959469 21:15142971-15142993 GTGGTGAAGTAGAGGAAGCATGG + Intergenic
1177094805 21:16819554-16819576 GAGGTGAAGCAGAGGAAGCAGGG - Intergenic
1177459228 21:21388475-21388497 TTGCTGAAGCTGAATAAGCAAGG + Intronic
1177802425 21:25841011-25841033 GTGCTGACACAGAGAAAGTAGGG + Intergenic
1177802944 21:25846371-25846393 GTGTTGGAGCAGGAAAAGGAAGG + Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1178710417 21:34911800-34911822 GTCCTGAGGCAGAAAAAGCTTGG - Intronic
1179410384 21:41158451-41158473 GGGAGGAAGCAGAAAAAGTATGG - Intergenic
1180709660 22:17831202-17831224 CTGCTGGAGCAGAGAAAGAATGG + Intronic
1181041056 22:20192806-20192828 GAGCTGAAGGAGCAACAGCAGGG - Intergenic
1181633522 22:24163773-24163795 GTGCTGCAGCAGGTAAAGCAAGG + Intronic
1181949490 22:26543827-26543849 TGGCTTAAGAAGAAAAAGCAGGG + Intronic
1182457244 22:30459795-30459817 TTGCAGAAGAGGAAAAAGCAAGG - Exonic
1183138311 22:35911867-35911889 TTGCTGGAGCAGTAAAAACAGGG - Intronic
1184024717 22:41846652-41846674 CTGCTGAAGTAGAGACAGCACGG - Intronic
1184180195 22:42816629-42816651 GTGCTGAAGGAGAGAAACCTAGG + Intronic
1184372855 22:44093588-44093610 CTGCTGAGGCAGACAAAGCATGG - Intronic
1185154442 22:49184613-49184635 CTGCTGTAGAAGACAAAGCAAGG - Intergenic
1185203298 22:49521727-49521749 GCGCTTTAGCAGGAAAAGCAGGG - Intronic
949252600 3:2005281-2005303 TGGCTGAAGCAGAGAAAGTAAGG + Intergenic
949433363 3:4002490-4002512 CTGATGAAAGAGAAAAAGCAAGG + Intronic
949946341 3:9192944-9192966 GAGCTGAAGCAGGAAGACCATGG + Intronic
950062375 3:10082660-10082682 GTGATGAGTCAGAAAAAGCTGGG - Intronic
951402546 3:22251525-22251547 GTGCTGAAGCTGAGAAATCCTGG - Intronic
952775418 3:37041304-37041326 ATGCTGGAAAAGAAAAAGCAAGG - Intronic
954510808 3:51123203-51123225 GGGCTGAAGCTGGAAAACCATGG - Intronic
954865167 3:53722827-53722849 GTGCTGGAGCATTCAAAGCAGGG - Intronic
955082067 3:55666755-55666777 GTGCTGAAGCTGAGAAATCCTGG + Intronic
955082160 3:55667875-55667897 GTGCTGAAGCTGAGAAATCCTGG - Intronic
956367655 3:68522456-68522478 TTACTGAAGCAGAAAAAGAAAGG + Intronic
956467662 3:69535602-69535624 TTGCTGAAGAATAAAAATCAGGG + Intronic
956544472 3:70385124-70385146 GTGGTGTAGAAGAAAAAGCACGG + Intergenic
956652188 3:71514380-71514402 GTGCAGGAGAAGAAAAACCAGGG - Intronic
959623501 3:108424081-108424103 GTGCTTAGGGTGAAAAAGCACGG + Intronic
959646946 3:108713928-108713950 GTCGTGTAGCAGAAAGAGCATGG - Intergenic
959705303 3:109333788-109333810 TTTCTGAAGAAGAAAAACCAGGG - Intronic
960184686 3:114624241-114624263 GTGCTGAAGCACAGAAATTAGGG + Intronic
960535234 3:118808257-118808279 GTTGTGAAGAAGAAAAAGCTAGG - Intergenic
960868937 3:122230386-122230408 GTGCTGGAGCAGAAAGATCTAGG - Intronic
961801916 3:129457454-129457476 GCCCTGAAGCAGGAAAAGCCTGG - Intronic
962411388 3:135144173-135144195 GTGCAGAACCAGAAACAGCTGGG - Intronic
962965693 3:140352091-140352113 GTTTTTAAGCAGAAAAACCAAGG - Intronic
963670195 3:148241828-148241850 GTGGTGAAGAAGAGAAAGAAGGG + Intergenic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
965449487 3:168820057-168820079 GTGCTGAACCAGAAAGAATAGGG + Intergenic
966108467 3:176365291-176365313 TTGCTGAACCAGACTAAGCAGGG + Intergenic
966583563 3:181596042-181596064 GTGTTCAAGCAGAGAAAGAAAGG + Intergenic
966658218 3:182383724-182383746 GTGCTGAGGCAGAGGAAGCAGGG - Intergenic
967062500 3:185884571-185884593 GTGAGGAAGTGGAAAAAGCAAGG + Intergenic
967381060 3:188858535-188858557 GTGCTTAAGAATAAAAAACAGGG + Intronic
967953183 3:194856636-194856658 GTGGTAATGCAGAGAAAGCAAGG + Intergenic
968448819 4:665661-665683 GTGCTGGGGCAGAGAACGCATGG + Intronic
968755396 4:2413332-2413354 GTGCTGATGTGGAAAAAGGAAGG + Intronic
969338416 4:6525673-6525695 GTGTTGAAACTGAAAAAGAAAGG - Intronic
969346205 4:6571739-6571761 GGGCTGGAGCTGAAACAGCATGG + Intergenic
970290186 4:14563493-14563515 TTGCTGATTCAGAAAAAGGAGGG + Intergenic
970450052 4:16157400-16157422 GTGCTGAATCAGAAACTTCAGGG - Intergenic
970689328 4:18603888-18603910 GTGAAGAAGAAGAGAAAGCAGGG - Intergenic
971241192 4:24890418-24890440 GTGCTGTGGCAGAAAGGGCATGG - Intronic
972230406 4:37065997-37066019 ATCCTGAAGAAGAAAGAGCATGG + Intergenic
972803438 4:42502566-42502588 GTGATGCAGAAGCAAAAGCAGGG - Intronic
973010429 4:45065957-45065979 CAGGTGAAGCAGAAAATGCAAGG + Intergenic
973597976 4:52512102-52512124 GTAGTTAAACAGAAAAAGCAGGG - Intergenic
974601922 4:64094410-64094432 GTGCTCAAGGAGATAAAGCTAGG + Intergenic
975759613 4:77606183-77606205 GAGCTGAATCAGAAAAAGGCTGG - Intronic
976344241 4:83981768-83981790 GTGTAGAATGAGAAAAAGCAAGG + Intergenic
976731992 4:88272194-88272216 GAGCTGAAGCAGTAGCAGCACGG + Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977855553 4:101886318-101886340 TGGCTGAAGCAGAAACAGCAAGG + Intronic
978053825 4:104238204-104238226 ATGCTGGAGCACACAAAGCAAGG - Intergenic
978254402 4:106676339-106676361 GTGGTGAAACAAAACAAGCAGGG + Intergenic
978436971 4:108695902-108695924 GTTTTGAAGCTGAACAAGCAAGG + Intergenic
979473364 4:121126575-121126597 GCGCTGAAGCAGAAGAAAAATGG - Intergenic
980101311 4:128543897-128543919 GTGCTGAAGCAGAACCAACATGG - Intergenic
982071883 4:151702791-151702813 GGGCTTATGTAGAAAAAGCAGGG + Intronic
982448545 4:155524113-155524135 GTACAGATGCAGAACAAGCAGGG - Intergenic
982623305 4:157732618-157732640 GGGCTGAAGGAGAGAAGGCAGGG + Intergenic
984164730 4:176293618-176293640 GTGCAGCAGCAGAAAATGTAGGG + Intergenic
984824044 4:183907775-183907797 ATGCTGAAGGAGGAAAAGCCTGG + Intronic
984920559 4:184760737-184760759 GTGGTGACGCTGAATAAGCACGG - Intronic
985774885 5:1836049-1836071 GTGCTGTGCCAGAAAAATCATGG + Intergenic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
987246847 5:16057832-16057854 GTGTTGAAGAAGAAAAAGAAAGG + Intergenic
987265486 5:16249476-16249498 GTGCTGATTTATAAAAAGCAAGG - Intergenic
989642963 5:43601676-43601698 GTGCTGAGGCTGAAAAATCCTGG - Intergenic
990029983 5:51246678-51246700 CAGCTGAAGCAGAGAAAGCATGG + Intergenic
990048693 5:51468191-51468213 GGGCTGAACCAAAAAAGGCATGG - Intergenic
990282341 5:54264609-54264631 TGGCTGAAGCAGAAAGAGTAGGG - Intronic
990981594 5:61606921-61606943 GAGCTGAGGCAGAAGAGGCAAGG + Intergenic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
992197485 5:74354339-74354361 GTGCTGCAGCAGACATGGCATGG - Intergenic
993817785 5:92574109-92574131 CTGCTCATGCAGAAAAAGAAAGG + Intergenic
994089462 5:95796993-95797015 GTGCTCAGGCAGAAAAGACAGGG - Intronic
994184884 5:96806593-96806615 TTGGTGAAGCTGAAAAAGCAGGG - Intronic
995000103 5:107117208-107117230 GGGCTGTAGCTGAAACAGCATGG + Intergenic
995830505 5:116349362-116349384 CTGATGAAGAGGAAAAAGCAGGG + Intronic
995856070 5:116593649-116593671 CTGCTTAAGCTGAAAAAGCAGGG + Intergenic
997405009 5:133638662-133638684 GTGCTATGGGAGAAAAAGCAGGG - Intergenic
998826666 5:146108604-146108626 GTTCTGAAACAGAAAACACAAGG + Intergenic
999184331 5:149694410-149694432 TTGCTGAAGGAGAGAAACCAAGG + Intergenic
999387551 5:151165319-151165341 CAGCTGAATTAGAAAAAGCAGGG + Intergenic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
999495948 5:152097099-152097121 CTGCCTAAGCAGAGAAAGCAGGG + Intergenic
999793545 5:154966141-154966163 ATGCTGAAGCATAGTAAGCAAGG - Intronic
1000580041 5:163025438-163025460 GTAATGTAGTAGAAAAAGCATGG - Intergenic
1000694501 5:164363241-164363263 GCACTGAATCAGAAAAATCAAGG + Intergenic
1000901828 5:166920822-166920844 TGGCTGCACCAGAAAAAGCAAGG - Intergenic
1001598900 5:172916186-172916208 GTGCTAAAGCAGAAGCTGCAAGG + Intronic
1002408680 5:179056007-179056029 TTGCTGAAGCAGAAAGAAAAGGG - Intergenic
1002622194 5:180495401-180495423 GTGCTGAAAAACAAAAAGGAGGG - Exonic
1003511464 6:6784708-6784730 GTGCAGAAGCAGTGCAAGCAGGG - Intergenic
1004563977 6:16778431-16778453 GTGTTGAAACAATAAAAGCAAGG + Intergenic
1005609217 6:27507458-27507480 GTGCTAAGGCAGCAACAGCAAGG - Intergenic
1006160908 6:32040177-32040199 GTGGTGAAGCAAAAAAACCACGG - Exonic
1006467358 6:34203565-34203587 ATGCAGAAGCAGGAAAAGAATGG + Intergenic
1009369900 6:62886124-62886146 GTGCAAAAGCAGAAAAGGGAGGG + Intergenic
1010309182 6:74363538-74363560 TTGCTGAAGTAGAAAAATGAAGG + Intergenic
1010897267 6:81379696-81379718 TTGCTGAAACTGAAAAACCAAGG + Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013659385 6:112279290-112279312 GTCCAAAACCAGAAAAAGCATGG - Intergenic
1014771615 6:125464206-125464228 GTGCTTAAGTAGAGAAAGAATGG + Intergenic
1014986024 6:128010806-128010828 ATTCTCAAGCAGAAAAAGCAAGG + Intronic
1015254488 6:131162659-131162681 GAGCTCGGGCAGAAAAAGCAAGG - Intronic
1016738328 6:147504838-147504860 GCACTGAAGCAAAAAAAGAAGGG - Intergenic
1017255877 6:152332848-152332870 GTTCTGAAGTATGAAAAGCAGGG + Intronic
1017461429 6:154654748-154654770 GTGATGAAGCAGAAAAAGCTTGG + Intergenic
1020321318 7:6940625-6940647 GTGGTGAAGCATGAAATGCAGGG - Intergenic
1020433623 7:8138566-8138588 ATGCTGTAGTAGAAAAAACATGG - Intronic
1020656030 7:10929088-10929110 GTTCCTAAGCAGAAAAAGAAAGG - Intergenic
1020815779 7:12903713-12903735 GTGTTGAAGCAGAAAAACGTAGG - Intergenic
1021336430 7:19408324-19408346 CTGCTGAGGCAGAACAAGCAAGG - Intergenic
1021852793 7:24824951-24824973 GGTATGAAGCAGAAGAAGCAAGG + Intronic
1021960237 7:25863192-25863214 GCACTGAAGCAGAGAAAGGATGG + Intergenic
1022131923 7:27412372-27412394 GTCCTGAGGCAGAAACAGAAAGG - Intergenic
1022455493 7:30554824-30554846 GGGCTGAAGCAGAGAACCCAAGG - Intergenic
1022793616 7:33714378-33714400 GGGCTGCAGCAGAAAGAGCCTGG - Intergenic
1023054287 7:36279174-36279196 CTGGTGAAGCAGAAAACTCAAGG - Intronic
1024207934 7:47179765-47179787 GTGCAGAAGGAGAAAGAGAAGGG + Intergenic
1024533154 7:50409724-50409746 GTCAAAAAGCAGAAAAAGCAAGG - Intergenic
1026324791 7:69299718-69299740 CTGCTGGAACAGAACAAGCAAGG - Intergenic
1027279864 7:76600367-76600389 GTGCTGGAGTAGAAAAAAGAAGG - Intergenic
1027358819 7:77386757-77386779 GAGCTAAAGCAAAAAAGGCAGGG + Intronic
1028231038 7:88306743-88306765 GAGCTGAAGCAGATAAGGGACGG + Intronic
1028331908 7:89605260-89605282 GTGCTGCAGCTGGAAAACCAAGG - Intergenic
1029104805 7:98166156-98166178 GTGCTGATGGAGGAAATGCAGGG - Intronic
1029172629 7:98641681-98641703 TTGCTGAAAGAGAAAGAGCAGGG - Intergenic
1030026484 7:105329388-105329410 ATTCTGAAACAGAAAGAGCAGGG + Intronic
1030484907 7:110153029-110153051 ATGCAGAAGAAGAAAAGGCAAGG + Intergenic
1030824288 7:114135992-114136014 ATACTGAAGAAGAAAAAGCGGGG - Intronic
1031251956 7:119395152-119395174 CTTCTGCAGTAGAAAAAGCAAGG + Intergenic
1033240402 7:139674460-139674482 GTGCTGAGCCTGAAAGAGCAAGG + Intronic
1033920975 7:146391305-146391327 ATGCTCCAGCACAAAAAGCAAGG - Intronic
1036666966 8:10752486-10752508 GTGCTGAAAGAGTTAAAGCATGG - Intronic
1038150165 8:24936115-24936137 GTGCTGGAGAAGAAAAAGGATGG + Intergenic
1039992131 8:42497468-42497490 GTGCTGACGCTGAAGAAACAGGG + Intronic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1041182467 8:55263054-55263076 GAACTGAGGCAGAAAGAGCAGGG - Intronic
1041414021 8:57587569-57587591 TTGCTGATGCAGAAAAAGAGTGG - Intergenic
1042567218 8:70124233-70124255 TTGCTGAAGCCGAGACAGCAGGG + Intronic
1044160690 8:88910939-88910961 ATTCTGAAACAGAAAGAGCAGGG + Intergenic
1044826738 8:96205793-96205815 TGGCTGGAGCAGGAAAAGCAAGG - Intergenic
1044843177 8:96355436-96355458 ATGCTGAAGAAGAGAAAACATGG + Intergenic
1046029003 8:108760804-108760826 GTGTTGAACCAGTAAAAGCTTGG - Intronic
1047010951 8:120672029-120672051 GTACTGAAAGTGAAAAAGCAGGG - Intronic
1047524781 8:125623473-125623495 GTTCTAGAGCAGAGAAAGCACGG - Intergenic
1049309994 8:141928727-141928749 GTGCTGAGGCTGAAAAACCCTGG - Intergenic
1050143926 9:2545407-2545429 GGGCTGAAGCTCAAGAAGCATGG + Intergenic
1050181501 9:2927826-2927848 GTGATGAAGCTGAAGAAACATGG - Intergenic
1050309253 9:4335965-4335987 GTGATGAAGAAGAAAGGGCAGGG + Intronic
1050357596 9:4797644-4797666 GTGCTGATGTAGAAAAACCCTGG + Intronic
1050592095 9:7171493-7171515 GTGCTGAAAAAGGAAAAGAAAGG - Intergenic
1050876140 9:10639306-10639328 ATAGTGAACCAGAAAAAGCAAGG + Intergenic
1051493941 9:17697769-17697791 TTGCAGAAGCAGAAAATGCTAGG + Intronic
1052742427 9:32405998-32406020 GTGCAAAGGCAGAAAAAGGACGG - Intronic
1052944138 9:34153878-34153900 ATGGTGTAACAGAAAAAGCATGG + Intergenic
1053148294 9:35726929-35726951 TTGCTGAAGAGGAGAAAGCATGG - Intronic
1053196134 9:36120446-36120468 GTGGTGAAGGATGAAAAGCAGGG + Intronic
1055253231 9:74334011-74334033 GTGCAGAAGAAAAAAAAGCATGG - Intergenic
1057363508 9:94397104-94397126 ATCCTGAAGGAGAAAAAGAAAGG - Intronic
1057659828 9:96990993-96991015 ATCCTGAAGGAGAAAAAGAAAGG + Intronic
1057964476 9:99489719-99489741 GTGCTGAGGCACAGAAAACATGG - Intergenic
1059292162 9:113235817-113235839 TTGCCAAAGCAGAAACAGCAAGG - Intronic
1060271634 9:122146942-122146964 GAGCTGAGGCTGAAGAAGCAGGG + Intronic
1060418897 9:123453404-123453426 GTGCAGAAGCTGAAAAGCCATGG + Intronic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1062452829 9:136622699-136622721 GTGATGAGGCAGAAGAGGCAGGG - Intergenic
1062608265 9:137358495-137358517 GTGCTGAACCTGCAAATGCAAGG - Intronic
1186444024 X:9610605-9610627 ATGCAGAAGCAGCAAAAGAATGG - Intronic
1187023121 X:15405500-15405522 GTGCAGAATGAGAAAAAGCAGGG - Intronic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187572540 X:20519470-20519492 GGGCTGAAGTAGAGAGAGCAAGG - Intergenic
1191201923 X:57792306-57792328 GTAATGAAGCAGTGAAAGCAGGG - Intergenic
1195218209 X:102721277-102721299 GTGCTGGATCAGGAAAGGCAGGG + Intronic
1196101873 X:111855223-111855245 GTGCTCAAGGAGAAGAAGAATGG - Intronic
1198140540 X:133798342-133798364 GTACTAAAGCATAAAAAGAAGGG - Intronic
1199401184 X:147400739-147400761 GTGCTTAAGCAGAGAAAAGATGG - Intergenic
1199463705 X:148112309-148112331 GTTATGAAACAGAAAAATCAGGG - Intergenic
1199538707 X:148933249-148933271 CAGCTGAAGCAGAGTAAGCAAGG + Intronic
1201534020 Y:15025448-15025470 ATGCTGGAGGAGAAAAATCAGGG - Intergenic
1202364874 Y:24152434-24152456 GCTCTGCAGCAGAAAATGCATGG - Intergenic
1202505907 Y:25517688-25517710 GCTCTGCAGCAGAAAATGCATGG + Intergenic