ID: 1067724880

View in Genome Browser
Species Human (GRCh38)
Location 10:48762511-48762533
Sequence CTGTGGGTCAGGGATTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067724875_1067724880 -3 Left 1067724875 10:48762491-48762513 CCGTGTCATTTCTCATGGTTCTG 0: 1
1: 0
2: 3
3: 22
4: 313
Right 1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067724880 Original CRISPR CTGTGGGTCAGGGATTCAGA AGG Intronic
No off target data available for this crispr