ID: 1067724892

View in Genome Browser
Species Human (GRCh38)
Location 10:48762583-48762605
Sequence GCTAAAGAGGTCATCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067724892_1067724901 13 Left 1067724892 10:48762583-48762605 CCTCCCAGGATGACCTCTTTAGC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1067724901 10:48762619-48762641 CAAGGCTGGCTCCCTGGCAAAGG No data
1067724892_1067724897 -5 Left 1067724892 10:48762583-48762605 CCTCCCAGGATGACCTCTTTAGC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1067724897 10:48762601-48762623 TTAGCTGTGGCACCTCAGCAAGG No data
1067724892_1067724905 26 Left 1067724892 10:48762583-48762605 CCTCCCAGGATGACCTCTTTAGC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data
1067724892_1067724900 7 Left 1067724892 10:48762583-48762605 CCTCCCAGGATGACCTCTTTAGC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1067724900 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG No data
1067724892_1067724898 -1 Left 1067724892 10:48762583-48762605 CCTCCCAGGATGACCTCTTTAGC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1067724898 10:48762605-48762627 CTGTGGCACCTCAGCAAGGCTGG No data
1067724892_1067724902 14 Left 1067724892 10:48762583-48762605 CCTCCCAGGATGACCTCTTTAGC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1067724902 10:48762620-48762642 AAGGCTGGCTCCCTGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067724892 Original CRISPR GCTAAAGAGGTCATCCTGGG AGG (reversed) Intronic
903182450 1:21611793-21611815 GCTGAAGAGTTCTTCCTCGGAGG + Exonic
904073791 1:27824398-27824420 GCCAAAGAGGTTCTCCTAGGTGG + Exonic
904473958 1:30752510-30752532 GGAAAAGAGGTCACGCTGGGCGG - Intronic
904495572 1:30884549-30884571 GGGAAAAAGGGCATCCTGGGGGG - Intronic
904686722 1:32266194-32266216 GCTCAAGAGATCCTCCTGGCCGG + Intronic
907396209 1:54191783-54191805 GATGAAGAGGTCATCCTGGATGG - Intronic
909163200 1:72181298-72181320 GCTAGAGAGGACAACCTGGATGG + Intronic
914469157 1:147958846-147958868 GGTAATGGGGTCATGCTGGGAGG - Intronic
919424724 1:197415936-197415958 GATAAAGAGGTCCTTGTGGGCGG - Intronic
920685119 1:208103350-208103372 CCTAAAGAGGTGATACTGGGCGG + Intronic
921375754 1:214471808-214471830 TCTGAAGAGCCCATCCTGGGTGG + Intronic
922798533 1:228353357-228353379 GCTGGAGAGGTCACTCTGGGTGG + Intronic
1062831973 10:611574-611596 GCTAAAGAGGCCCTGGTGGGAGG - Intronic
1067061578 10:43080579-43080601 GCTAAGGAGGGCTTCCAGGGAGG + Intronic
1067724892 10:48762583-48762605 GCTAAAGAGGTCATCCTGGGAGG - Intronic
1075595334 10:123725102-123725124 GCTTGAGAGGTCAGCCTGCGCGG + Intronic
1076197182 10:128527209-128527231 CCTGAAGAGGACATCCTCGGAGG + Intergenic
1078430365 11:11283485-11283507 GCTAACCAGGTCACTCTGGGTGG + Intronic
1078987536 11:16610197-16610219 CCTAAAGAGGTCATCATTGAAGG + Intronic
1079726034 11:23882531-23882553 ACTAAAGAGGTAGTGCTGGGTGG - Intergenic
1080029949 11:27649897-27649919 GGTAAAGAGGTCATTCTGAGTGG - Intergenic
1083540944 11:63511161-63511183 GCTAATGAGCTCAGCCTGGTAGG + Intronic
1088312896 11:108478364-108478386 GCTGAAGAGTACTTCCTGGGTGG - Intronic
1090027608 11:123181102-123181124 GCTATAGAGGTCACGCTGTGTGG - Intronic
1094211836 12:27901274-27901296 GCTAAAGAGGGAAGACTGGGCGG - Intergenic
1099081224 12:78184043-78184065 GATAGATAGGTCATCCTGGAAGG - Intronic
1100722349 12:97372348-97372370 GCTGAAGAGGCCATCATGAGTGG + Intergenic
1103967927 12:124652080-124652102 GCACATGAGGTCATCCTGGCAGG + Intergenic
1105329883 13:19405773-19405795 GCTCAAGTGATCAACCTGGGAGG - Intergenic
1108167706 13:47710173-47710195 TCTACAGGGGTCCTCCTGGGAGG + Intergenic
1114823885 14:26053851-26053873 GCTAGAGAGGTCAGGATGGGAGG - Intergenic
1120384896 14:83832377-83832399 GCTCAAGAGGTCCTCCTGCCTGG - Intergenic
1120842455 14:89097653-89097675 TCCAAAGGGGTCAACCTGGGTGG + Intergenic
1124379377 15:29151827-29151849 GCTGAAGAGGAGATCCTGCGAGG + Exonic
1129247448 15:74288139-74288161 GATGGAGAGGGCATCCTGGGTGG - Intronic
1129767236 15:78178097-78178119 GCTAATGAGGACATCCAGAGAGG - Intronic
1130182575 15:81645467-81645489 GATGAAGAGGGCATCCTGAGGGG + Intergenic
1130332959 15:82935473-82935495 GCTAGTGAGGTCACCCAGGGAGG - Intronic
1138606862 16:58095241-58095263 TCACCAGAGGTCATCCTGGGGGG - Intergenic
1142023953 16:87802288-87802310 AGTTAAGGGGTCATCCTGGGAGG - Intergenic
1147994879 17:44354963-44354985 GCGGAAGAAGTCATCCCGGGAGG + Exonic
1148832209 17:50440974-50440996 GCTGAAGGGGCCATCCCGGGAGG + Intronic
1149439068 17:56660177-56660199 TTGAAAGAGGTCTTCCTGGGAGG - Intergenic
1154339974 18:13494776-13494798 GATAAAGCCTTCATCCTGGGAGG - Intronic
1156235086 18:35195371-35195393 GCTAATGAGGTCTTTCTGAGTGG + Intergenic
1161481451 19:4512797-4512819 GCCAAAGAGGCCATCCAGGGGGG - Exonic
1163375059 19:16925054-16925076 GCAAAAGAGGCCATTCAGGGTGG - Intronic
1165403735 19:35617857-35617879 GCCAAAGTGGTCATCATGAGGGG - Exonic
926676446 2:15626695-15626717 GCAAAAGAGATCATTCTTGGAGG - Intronic
926783265 2:16495238-16495260 CCTAGAGAGATCATCCTAGGAGG + Intergenic
932334837 2:70924308-70924330 GCTAATGAGGTGATTCAGGGTGG - Intronic
932916910 2:75869001-75869023 GCTTAAAAGTTCTTCCTGGGAGG + Intergenic
932961968 2:76423144-76423166 ACTAAAGAGTTCTTGCTGGGAGG - Intergenic
933737888 2:85509953-85509975 GTTAAACAGGGCATCCAGGGTGG + Intergenic
937625248 2:124036222-124036244 GATTAAGAGTTCATCCTGGGAGG - Intronic
938980248 2:136519516-136519538 GCTCAAGAGGTCCTCCTTGCTGG - Intergenic
942028573 2:171935642-171935664 GCTAAAGTGATCATCCTGCCTGG - Intronic
944656242 2:201879291-201879313 TCTAAAGAGGTGATTCTGGAGGG - Intronic
945040909 2:205743272-205743294 GCTCCAGAGGTATTCCTGGGTGG - Exonic
948482946 2:238261871-238261893 GCCAGAGAGGTCCTCCTGTGGGG - Intronic
949034775 2:241811423-241811445 GCTGCAGAGCTCATCATGGGTGG - Exonic
1169263247 20:4152631-4152653 GATGAGGAGGGCATCCTGGGTGG + Intronic
1170881427 20:20299696-20299718 GCTACAGACATCATCCTGGATGG - Intronic
1173593335 20:44242140-44242162 GAGAAAAAGGACATCCTGGGAGG - Intergenic
1174804412 20:53593630-53593652 GGAACTGAGGTCATCCTGGGGGG + Intronic
1177935147 21:27335755-27335777 GGTAAAGAAGTCAAACTGGGAGG + Intergenic
1180560331 22:16610061-16610083 GGAACTGAGGTCATCCTGGGGGG + Intergenic
1180565011 22:16656055-16656077 GCTCAAGTGATCAACCTGGGAGG + Intergenic
1183535436 22:38398313-38398335 GGAACTGAGGTCATCCTGGGGGG + Intronic
949729250 3:7088888-7088910 GGCAAAGAGGACATCCTGTGAGG + Intronic
950106275 3:10391104-10391126 TCTACAGAGGTCAGCTTGGGTGG - Intronic
954794239 3:53153435-53153457 GCTTAAGAGGTTAGCCAGGGAGG + Intergenic
965220992 3:165925241-165925263 GATGAAGAGTTTATCCTGGGTGG + Intergenic
965274535 3:166663973-166663995 GCTAATGAGGTGATCCAGGGTGG - Intergenic
965615786 3:170591120-170591142 GCTTCAGAGTTCACCCTGGGTGG + Intronic
970005568 4:11407679-11407701 ACTAAAGATTTCCTCCTGGGAGG + Intronic
970242222 4:14021518-14021540 AAAAGAGAGGTCATCCTGGGTGG + Intergenic
970242231 4:14021557-14021579 AAAAGAGAGGTCATCCTGGGTGG + Intergenic
970525939 4:16932222-16932244 GGTAAAGAGCTGGTCCTGGGAGG - Intergenic
971147578 4:23995684-23995706 GCTAAAGAGTTCCTTCTGTGGGG + Intergenic
977662470 4:99606760-99606782 GCTAAGAAGTTAATCCTGGGAGG + Exonic
978622305 4:110644945-110644967 GCTGAAGAAGACATCTTGGGTGG + Intergenic
983381460 4:166999883-166999905 CCTAAAGAAGGCATCCTGAGGGG + Intronic
986180261 5:5386469-5386491 GATACAGAGATTATCCTGGGTGG + Intergenic
986205358 5:5620017-5620039 GCTAAGGAGGTCAGCGGGGGAGG - Intergenic
991095969 5:62739942-62739964 GATCAAAAGGTCATCCTGGAAGG - Intergenic
991147507 5:63324048-63324070 GCTAAAGTCTCCATCCTGGGAGG + Intergenic
992461354 5:76963409-76963431 GCTAAAGGCGTCATCTTGGAAGG - Exonic
996467020 5:123814840-123814862 ACTTAGGAGGCCATCCTGGGAGG + Intergenic
1000151070 5:158501453-158501475 GATAAACACGTCATACTGGGTGG + Intergenic
1001195898 5:169673242-169673264 GCTAATGAGGTGATTCTAGGTGG - Intronic
1002088159 5:176788798-176788820 GATAAAGAGCTCTTTCTGGGGGG - Intergenic
1003652077 6:7970150-7970172 GCTAATGAGGTGATCCATGGTGG + Intronic
1007949469 6:45858574-45858596 GGTGAGGAAGTCATCCTGGGCGG - Intergenic
1011648072 6:89479160-89479182 GATAAACAGGGCATCATGGGAGG + Intronic
1012356637 6:98322337-98322359 GCTACAGTGGTCATCCAGGCAGG - Intergenic
1013796900 6:113898494-113898516 GCTAGAGAGGGAATTCTGGGGGG - Intergenic
1014706432 6:124753357-124753379 GCTAAAGAGATTATCTTAGGAGG - Intronic
1015208819 6:130672311-130672333 GAAAAAGAGATTATCCTGGGTGG + Intergenic
1017543730 6:155428889-155428911 GCTGAAAAAGTCCTCCTGGGGGG + Exonic
1019513327 7:1429197-1429219 GCTAAACAGGGCTTCCGGGGAGG + Intronic
1020478652 7:8629989-8630011 GCTAAAGAGGCCAAGATGGGTGG + Intronic
1021541856 7:21768518-21768540 GTGAAAGAGGTCATCTTTGGGGG + Intronic
1022812614 7:33884692-33884714 GTCAAAATGGTCATCCTGGGTGG + Intergenic
1022872809 7:34497236-34497258 GCTAAAGAGGTCCTCTTGGAAGG + Intergenic
1024589014 7:50864900-50864922 GTTAATGAGGTCATCAAGGGGGG - Intergenic
1030266012 7:107622666-107622688 AGTGAAGAGGTCATCCTGAGGGG + Exonic
1033726374 7:144123140-144123162 GCTAATGAGGCCTTCTTGGGAGG - Intergenic
1034594533 7:152177203-152177225 CCTTAAGAGGTCATCCAGGTTGG + Exonic
1039684203 8:39779381-39779403 GTTAAATAGGTCATGGTGGGGGG - Intronic
1041881453 8:62755621-62755643 GGTAAAAGGGTAATCCTGGGAGG - Intronic
1046488856 8:114920589-114920611 GATAAAGAGGTGAAGCTGGGAGG + Intergenic
1047348273 8:124049395-124049417 CCTAAAAGGGTCATCCTGGCTGG - Intronic
1050321320 9:4455510-4455532 ACTAAACAAGTTATCCTGGGTGG + Intergenic
1050354300 9:4768878-4768900 GCCAAAGTGTTCATCTTGGGTGG + Intergenic
1053228375 9:36382300-36382322 GTCAAAGAGGTCATAATGGGAGG + Intronic
1057620671 9:96631747-96631769 GCTCAAGAGGTCCTCCTGCCTGG + Intergenic
1061872020 9:133526166-133526188 GCTCAAGAGAATATCCTGGGTGG - Intronic
1188908544 X:35817827-35817849 GCTAAAGTCTTCATCTTGGGAGG + Intergenic
1190089041 X:47421533-47421555 GCTAAAGAGGTCTACCTGGAAGG - Intergenic
1190562319 X:51697523-51697545 CATAAGGAGGTTATCCTGGGTGG + Intergenic
1192057779 X:67789835-67789857 GAGAAAGAGATCATCCTGAGAGG + Intergenic
1195295580 X:103473317-103473339 GCTAAAGAGGTTACCATGGATGG + Intergenic
1195475198 X:105277462-105277484 GACAAAGATGTCATCCAGGGTGG - Intronic
1196377205 X:115046509-115046531 GCTAAAGAGGTGACTCTTGGAGG + Intergenic
1198065808 X:133095696-133095718 GCTAAAGAGGTCCTCATACGTGG + Intronic
1202601398 Y:26597023-26597045 GCTGAAGTGATCAACCTGGGAGG + Intergenic