ID: 1067724893

View in Genome Browser
Species Human (GRCh38)
Location 10:48762586-48762608
Sequence ACAGCTAAAGAGGTCATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067724893_1067724900 4 Left 1067724893 10:48762586-48762608 CCCAGGATGACCTCTTTAGCTGT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1067724900 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG No data
1067724893_1067724897 -8 Left 1067724893 10:48762586-48762608 CCCAGGATGACCTCTTTAGCTGT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1067724897 10:48762601-48762623 TTAGCTGTGGCACCTCAGCAAGG No data
1067724893_1067724901 10 Left 1067724893 10:48762586-48762608 CCCAGGATGACCTCTTTAGCTGT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1067724901 10:48762619-48762641 CAAGGCTGGCTCCCTGGCAAAGG No data
1067724893_1067724905 23 Left 1067724893 10:48762586-48762608 CCCAGGATGACCTCTTTAGCTGT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data
1067724893_1067724898 -4 Left 1067724893 10:48762586-48762608 CCCAGGATGACCTCTTTAGCTGT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1067724898 10:48762605-48762627 CTGTGGCACCTCAGCAAGGCTGG No data
1067724893_1067724902 11 Left 1067724893 10:48762586-48762608 CCCAGGATGACCTCTTTAGCTGT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1067724902 10:48762620-48762642 AAGGCTGGCTCCCTGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067724893 Original CRISPR ACAGCTAAAGAGGTCATCCT GGG (reversed) Intronic
907192340 1:52659925-52659947 AACGCTAAAGTGGTCATCCGCGG + Intronic
907295959 1:53454502-53454524 GCAGCTAAGCAGGGCATCCTAGG + Intergenic
907309693 1:53532184-53532206 GCAGCCAGAGAGGTCTTCCTAGG - Intronic
908443823 1:64182628-64182650 AATGCTAAAGAGGAAATCCTGGG + Intergenic
909975560 1:82042534-82042556 ACATCTAAAGCTGTCACCCTGGG - Intergenic
914898274 1:151696329-151696351 AGAGCAAAAGATGCCATCCTAGG - Exonic
916549232 1:165833364-165833386 ACAGCAAATGCGGACATCCTTGG - Intronic
921609886 1:217199098-217199120 ACAGCAACAGAGATCAACCTTGG + Intergenic
922583208 1:226713764-226713786 ACAGCCAAAGAAAGCATCCTGGG + Intronic
924547511 1:245043728-245043750 ACAGCTAAAGAGGCCTTCCTGGG - Intronic
1063236431 10:4121458-4121480 ACATTTAAAAAGGTCATTCTTGG - Intergenic
1065138821 10:22700698-22700720 AATGCTACAGAGGTCATTCTCGG + Intronic
1067724893 10:48762586-48762608 ACAGCTAAAGAGGTCATCCTGGG - Intronic
1073834988 10:107430867-107430889 AAAGGTAAACAGGTTATCCTTGG + Intergenic
1073960446 10:108920831-108920853 CCAGTGAGAGAGGTCATCCTGGG + Intergenic
1077953347 11:6986544-6986566 ACAGCAAAAGAGATCATCAAAGG + Intergenic
1079798145 11:24833510-24833532 ACAGCTAAAGATCTCTCCCTGGG - Intronic
1082709916 11:56542192-56542214 TCAGCTAAAAAGCTCATGCTGGG - Intergenic
1082742945 11:56931081-56931103 ACAGCAAAAAAAGTCCTCCTTGG + Intergenic
1083799006 11:65035553-65035575 ACAGTTAAAGAGGAGATCCAGGG - Exonic
1087940087 11:104086104-104086126 ACAGCAAAAGAGGTCTCCCCTGG + Intronic
1089312683 11:117570235-117570257 AAATCTAAAGCGTTCATCCTTGG - Intronic
1096738027 12:53671538-53671560 ATAGCTAAGGAGTTCATTCTGGG - Intronic
1098917474 12:76272499-76272521 ACAGCAAAGGAGGCCAACCTCGG - Intergenic
1103589888 12:121984254-121984276 ACAGCCAAAGTGGTCATGGTGGG + Intronic
1111543390 13:89698148-89698170 ATATCTATAGAGGTCATCATAGG + Intergenic
1112618058 13:101026003-101026025 CCAGCTAAAGAGGTTGCCCTGGG - Intergenic
1113838635 13:113346351-113346373 TCAGCCACAGAGGTCCTCCTGGG - Intronic
1113838836 13:113347213-113347235 TCAGCCACAGAGGTCCTCCTGGG - Intronic
1113838917 13:113347569-113347591 TCAGCCACAGAGGTCCTCCTGGG - Intronic
1115499720 14:34038572-34038594 ACAGATAATGAGGCCATCTTAGG + Intronic
1119630618 14:76228799-76228821 TCAGAGAAAGAGGTTATCCTAGG + Intronic
1120039642 14:79738142-79738164 ACAGCTTAAGAAATTATCCTTGG - Intronic
1120612363 14:86657965-86657987 AGAGGTCAAGAGGTCATCCAAGG - Intergenic
1124115736 15:26842055-26842077 AAACCTAAAGTGGGCATCCTGGG + Intronic
1125265275 15:37872036-37872058 ACAGTGAAAGAGCTCTTCCTAGG + Intergenic
1126670396 15:51110658-51110680 AAGGCTATAGAGGTCATCCCAGG - Intergenic
1130023812 15:80253018-80253040 ACAGATAAAGAGGACATGATGGG - Intergenic
1130741959 15:86610490-86610512 ACAGCTAAAAAAGTCAGCCTGGG + Intronic
1135826392 16:25732415-25732437 AGAGCTACAGAGGTCAGCCTCGG - Intronic
1136249203 16:28992717-28992739 ACAGCTGAAGAGGTACACCTGGG + Intergenic
1138822177 16:60274513-60274535 ATAGCTAAAGAGATCATGCTGGG + Intergenic
1143279968 17:5746542-5746564 ACAGGTACAGAGGTTCTCCTGGG + Intergenic
1146914064 17:36666861-36666883 ACAGCAATGGAGGTCATCCATGG - Intergenic
1149030459 17:52077220-52077242 ATAGCTGAAGAAGTCATCGTTGG + Intronic
1150873519 17:68942772-68942794 AGAGCTCAAGAGGGCTTCCTAGG - Intronic
1156249590 18:35339853-35339875 CCAGCTCAAGTGGGCATCCTGGG - Exonic
1162333361 19:10044473-10044495 AACACTACAGAGGTCATCCTGGG + Intergenic
1167430340 19:49450648-49450670 ACACCCACAGAGATCATCCTAGG - Intronic
928390233 2:30904015-30904037 GCAGCCAGAGAGATCATCCTAGG + Intergenic
928447869 2:31349051-31349073 ACATCAAAACAGGACATCCTTGG + Intronic
930522224 2:52481860-52481882 AAAACTAAAGAAGTCATACTTGG + Intergenic
934849323 2:97687449-97687471 TCTGCTAAAGAGGACTTCCTTGG - Intergenic
935402406 2:102674238-102674260 ACAGCTACGGAGGTCAAGCTTGG + Intronic
937625249 2:124036225-124036247 ACAGATTAAGAGTTCATCCTGGG - Intronic
940719631 2:157267975-157267997 ACAGCTGAAGAGCTCTGCCTGGG - Intronic
943747981 2:191482338-191482360 ACAGCTAAAGAGAGCCTTCTTGG - Intergenic
947514716 2:230792406-230792428 ACAGACAGAGAGATCATCCTGGG - Intronic
1170099906 20:12687494-12687516 ATTGCTACAGAGTTCATCCTAGG + Intergenic
1171145243 20:22775668-22775690 AAAGCTAAAGAGATAATCCCAGG + Intergenic
1173881319 20:46414617-46414639 ACTGCTGAGGATGTCATCCTGGG + Intronic
1175933744 20:62505675-62505697 ACAGCTATGGAGGTGAACCTCGG - Intergenic
1178614918 21:34124148-34124170 ACATCTGGAGAGGTCAACCTAGG + Intronic
1181902890 22:26170037-26170059 GCAGCCAAAGAGGTTCTCCTTGG + Intronic
950377621 3:12584670-12584692 ACAGCTAATGAGAGCATTCTTGG - Intronic
956633922 3:71344471-71344493 ACAGCTAAAGTAGACATCTTTGG + Intronic
957163552 3:76641437-76641459 CCAGATTAAGAGTTCATCCTTGG + Intronic
965802690 3:172511035-172511057 AAAGCTAAAGAAGCCAGCCTGGG + Intronic
966597695 3:181739672-181739694 ACAGAAAAGGAGGTCCTCCTTGG - Intergenic
967084189 3:186079168-186079190 ACAGATAAAGAGGTCAGGTTTGG + Intronic
968887731 4:3344227-3344249 AAAGCTAAACAGGCCATCCAAGG - Intronic
970004097 4:11394412-11394434 AAAGCTAAAGAGGACATCATCGG - Exonic
970361659 4:15315145-15315167 AAGGCTAATGAGGTCAGCCTGGG - Intergenic
972265636 4:37456144-37456166 TGAGTTAAAGGGGTCATCCTAGG + Intronic
985120175 4:186631971-186631993 ACACCTTAACAGGTCAACCTGGG + Intronic
985227937 4:187782458-187782480 ACAGCTGCAGATGTGATCCTGGG - Intergenic
987422332 5:17735225-17735247 ACAGGTAAAGAAGTCCTCATTGG - Intergenic
989049431 5:37304790-37304812 AATACTAAAGAGCTCATCCTTGG + Exonic
993281711 5:85933474-85933496 ACAGCTAAAGGCTTCATCTTGGG + Intergenic
994296806 5:98099607-98099629 AAAGCAAAAGAGGTCATTGTGGG - Intergenic
997095726 5:130909114-130909136 ACAGCTAATAAGATCTTCCTAGG + Intergenic
1011328524 6:86177580-86177602 ACAGCAAAGAAAGTCATCCTGGG - Intergenic
1020926674 7:14336319-14336341 TCAGCTCAAAAGGTCATTCTTGG + Intronic
1021934143 7:25613717-25613739 ACTGCTAATGAGGACATCCATGG - Intergenic
1024135767 7:46406495-46406517 ACATCCATAGAGGTCATCCATGG - Intergenic
1027694809 7:81397565-81397587 ACAGCTAATGTGATCATCTTGGG - Intergenic
1031601664 7:123717382-123717404 ACAGCTAAAGAGGAGCCCCTAGG - Intronic
1032304686 7:130721578-130721600 ACAGCTAAAGAAGCAACCCTAGG - Intergenic
1033407399 7:141083547-141083569 ATTTCTAAAGAGATCATCCTGGG + Intronic
1039532176 8:38272560-38272582 AGAGCTAAAGATGAAATCCTGGG - Exonic
1042497526 8:69471646-69471668 ACAGCTAGAGAGGTGGTCCCTGG - Intronic
1045659645 8:104424131-104424153 ACAGCTAAAGAAGTCATCTAAGG + Intronic
1047532491 8:125689648-125689670 ACAACTTCAGAGCTCATCCTTGG - Intergenic
1050420772 9:5463100-5463122 ACAGCTGAATTGGTCATCCCAGG + Exonic
1052209042 9:25879301-25879323 CCAGCAAAAGAAGTCATCCCAGG + Intergenic
1052336796 9:27328667-27328689 ACAGCTACAGAGTTCCTCCAGGG + Exonic
1053098806 9:35352044-35352066 ACAGCTAGAGACTTCATCCACGG - Intronic
1054968529 9:71057988-71058010 AGAGTTAAAAAGGTCATCCATGG + Intronic
1059781962 9:117539099-117539121 TCAGCTCTAGAGGTCATCATCGG + Intergenic
1060856868 9:126921131-126921153 ACAGCTCAAGAGGTGCTTCTTGG - Intronic
1061746556 9:132744458-132744480 AAAGGCAAGGAGGTCATCCTCGG + Intronic
1185699525 X:2219929-2219951 ACAGCCAAAGGGTACATCCTTGG - Exonic
1189500699 X:41553859-41553881 ACAGGGGATGAGGTCATCCTTGG + Exonic
1190361556 X:49654371-49654393 ACATCCAAAGAGATCATTCTTGG - Intergenic
1194100037 X:89693017-89693039 ACAGCAGAAGAGGTCAAGCTGGG - Intergenic
1200453039 Y:3354376-3354398 ACAGCAGAAGAGGTCAAGCTGGG - Intergenic