ID: 1067724894

View in Genome Browser
Species Human (GRCh38)
Location 10:48762587-48762609
Sequence CACAGCTAAAGAGGTCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067724894_1067724898 -5 Left 1067724894 10:48762587-48762609 CCAGGATGACCTCTTTAGCTGTG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1067724898 10:48762605-48762627 CTGTGGCACCTCAGCAAGGCTGG No data
1067724894_1067724900 3 Left 1067724894 10:48762587-48762609 CCAGGATGACCTCTTTAGCTGTG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1067724900 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG No data
1067724894_1067724902 10 Left 1067724894 10:48762587-48762609 CCAGGATGACCTCTTTAGCTGTG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1067724902 10:48762620-48762642 AAGGCTGGCTCCCTGGCAAAGGG No data
1067724894_1067724905 22 Left 1067724894 10:48762587-48762609 CCAGGATGACCTCTTTAGCTGTG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data
1067724894_1067724897 -9 Left 1067724894 10:48762587-48762609 CCAGGATGACCTCTTTAGCTGTG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1067724897 10:48762601-48762623 TTAGCTGTGGCACCTCAGCAAGG No data
1067724894_1067724901 9 Left 1067724894 10:48762587-48762609 CCAGGATGACCTCTTTAGCTGTG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1067724901 10:48762619-48762641 CAAGGCTGGCTCCCTGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067724894 Original CRISPR CACAGCTAAAGAGGTCATCC TGG (reversed) Intronic
900483267 1:2909663-2909685 CACAGCCAAACGGGACATCCAGG - Intergenic
906269153 1:44460728-44460750 CCCAGCTAAAGAGGCCGTGCTGG + Intronic
909975561 1:82042535-82042557 CACATCTAAAGCTGTCACCCTGG - Intergenic
910260672 1:85290768-85290790 GAAAGCTGAAGTGGTCATCCAGG + Intergenic
921046400 1:211481000-211481022 AACAGATAACTAGGTCATCCAGG + Intronic
921152277 1:212412233-212412255 CACAGATAAAGAGGTCTCACTGG + Intronic
924547512 1:245043729-245043751 GACAGCTAAAGAGGCCTTCCTGG - Intronic
1067724894 10:48762587-48762609 CACAGCTAAAGAGGTCATCCTGG - Intronic
1071362317 10:84861187-84861209 CAGAACCAAAGAGGTAATCCTGG + Intergenic
1073253686 10:102137486-102137508 CAAAGCAAAAGAGGTCAGCAAGG - Intronic
1073803456 10:107069170-107069192 TCCAGCTAAGGTGGTCATCCCGG + Intronic
1073960444 10:108920830-108920852 CCCAGTGAGAGAGGTCATCCTGG + Intergenic
1075561216 10:123469996-123470018 CATAGCGAAAGATGACATCCGGG + Intergenic
1075825129 10:125349450-125349472 CACAGCTTAAGAGGGCTTCTCGG - Intergenic
1077801586 11:5544386-5544408 CACAAGCAAAGAGGTCATCAAGG + Intronic
1078102335 11:8337348-8337370 CACAGCCATGGAGGTGATCCAGG - Intergenic
1079802418 11:24887091-24887113 CACAGTGAAAGAGGTCAGGCAGG - Intronic
1080497286 11:32832244-32832266 CACAGATGAAGATGTCCTCCAGG - Intronic
1082709917 11:56542193-56542215 CTCAGCTAAAAAGCTCATGCTGG - Intergenic
1083799007 11:65035554-65035576 CACAGTTAAAGAGGAGATCCAGG - Exonic
1089349602 11:117814851-117814873 CACAGCTAATAAAATCATCCAGG - Intronic
1089802899 11:121051553-121051575 CACAGCTAAATAGTTCATGCAGG - Intronic
1096738028 12:53671539-53671561 CATAGCTAAGGAGTTCATTCTGG - Intronic
1103589887 12:121984253-121984275 CACAGCCAAAGTGGTCATGGTGG + Intronic
1104202082 12:126599420-126599442 ATCAGCTCAAGAGTTCATCCTGG - Intergenic
1104916260 12:132266406-132266428 CACTGATAAAGAGATCATCCTGG + Intronic
1105740714 13:23320192-23320214 CCCGGCTCAAGAGGTCCTCCTGG - Intronic
1105881603 13:24610963-24610985 CACAGCTGAAGAGATGAGCCGGG - Intergenic
1113838594 13:113346174-113346196 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838601 13:113346204-113346226 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838615 13:113346264-113346286 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838636 13:113346352-113346374 CTCAGCCACAGAGGTCCTCCTGG - Intronic
1113838698 13:113346620-113346642 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838718 13:113346708-113346730 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838726 13:113346738-113346760 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838762 13:113346888-113346910 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838782 13:113346976-113346998 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838790 13:113347006-113347028 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838837 13:113347214-113347236 CTCAGCCACAGAGGTCCTCCTGG - Intronic
1113838851 13:113347274-113347296 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838886 13:113347422-113347444 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838918 13:113347570-113347592 CTCAGCCACAGAGGTCCTCCTGG - Intronic
1113838925 13:113347600-113347622 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1113838965 13:113347778-113347800 CTCAGCCACAGAGGTCCTCCCGG - Intronic
1115080318 14:29442974-29442996 CACAGCTAAAGATATCAGACTGG - Intergenic
1122000334 14:98645415-98645437 TCCAGATATAGAGGTCATCCTGG - Intergenic
1122731900 14:103806510-103806532 GAAAGCTAAAGGGGTCTTCCTGG - Intronic
1124444384 15:29716292-29716314 CACACCTAATGATGTCATGCTGG - Intronic
1126347505 15:47711539-47711561 CACAGCTTAAGAGGGCATTTTGG + Intronic
1129388183 15:75207191-75207213 CATAGAGAGAGAGGTCATCCCGG - Exonic
1130741958 15:86610489-86610511 GACAGCTAAAAAAGTCAGCCTGG + Intronic
1133996381 16:10751711-10751733 CACAACTAAAGAGCTTTTCCAGG + Intronic
1136249202 16:28992716-28992738 CACAGCTGAAGAGGTACACCTGG + Intergenic
1138822176 16:60274512-60274534 TATAGCTAAAGAGATCATGCTGG + Intergenic
1143279967 17:5746541-5746563 CACAGGTACAGAGGTTCTCCTGG + Intergenic
1145976281 17:28986105-28986127 CACAGCTTAAGAGCTAATGCGGG - Intronic
1150346524 17:64408875-64408897 CACAGCTGAAGTGGTGATGCTGG + Intronic
1153558688 18:6347086-6347108 CACATATAAAGAGATCATACAGG - Intronic
1157721901 18:49931778-49931800 CACTGCTAAAGCTGTCAGCCAGG + Intronic
1160306374 18:77742822-77742844 CACAGCTAATGAGGTGAACAAGG - Intergenic
1163418907 19:17203312-17203334 CACTGCTCAAGAGGTCTTCAGGG + Intronic
1164178656 19:22800690-22800712 CACACTTCAGGAGGTCATCCAGG - Intergenic
1165845576 19:38815976-38815998 CCCAGACAAAGAGGTCATGCTGG - Exonic
1166970636 19:46564980-46565002 CACAGCCAAAGAGGTGAACAAGG + Intronic
926954440 2:18279279-18279301 TACAGCCAAAGAGCTCAGCCTGG + Intronic
927969137 2:27293513-27293535 CACAGACAAACAGGTCATTCTGG + Intronic
930168753 2:48230181-48230203 AATAGCTAAAGAGGTCATGTTGG + Intergenic
935831623 2:107006606-107006628 CACAGGGAAAGAGGTCGTCAGGG - Intergenic
936153166 2:110032684-110032706 GACAGCAAAAGAGGTTTTCCAGG + Intergenic
936191515 2:110338731-110338753 GACAGCAAAAGAGGTTTTCCAGG - Intergenic
937625250 2:124036226-124036248 CACAGATTAAGAGTTCATCCTGG - Intronic
938549811 2:132369726-132369748 CACAGGTAAAGCTGACATCCTGG - Intergenic
940719632 2:157267976-157267998 CACAGCTGAAGAGCTCTGCCTGG - Intronic
941755582 2:169182273-169182295 CAGAGACAAAGAGGCCATCCAGG + Exonic
944769153 2:202896105-202896127 CACTGCTGTAGAGGTCATGCTGG - Exonic
945390208 2:209256650-209256672 CAGAGCTCAAGAGGTAATGCTGG + Intergenic
947514717 2:230792407-230792429 CACAGACAGAGAGATCATCCTGG - Intronic
948633080 2:239314336-239314358 CAAAACAAGAGAGGTCATCCAGG + Intronic
1169424762 20:5487170-5487192 CACATCTAAAAAGAACATCCGGG + Intergenic
1169427516 20:5508260-5508282 CACATCTAAAAAGAACATCCGGG - Intergenic
1170881428 20:20299700-20299722 CACAGCTACAGACATCATCCTGG - Intronic
1173881318 20:46414616-46414638 CACTGCTGAGGATGTCATCCTGG + Intronic
1178710111 21:34909640-34909662 CTCAGCTGAAGAGGTCACTCTGG - Intronic
1179059612 21:37967597-37967619 CACAGCTAAAGAGCTAATTTTGG + Intronic
1180203565 21:46242950-46242972 AACAGATAAAGAGGCCAGCCTGG + Intronic
1181873154 22:25919014-25919036 CAAAGTGAAAGAGGTTATCCAGG - Intronic
1182262102 22:29080774-29080796 CACAACTAAAGAGGTACTACTGG + Intronic
1184243853 22:43226164-43226186 CACAGTTAAACAGGTCTTCTTGG - Intronic
1184777228 22:46629212-46629234 CACAGCTAAGGAACTCAGCCTGG - Intronic
1184996082 22:48208659-48208681 CACAGCTTAGGAGGCCTTCCGGG + Intergenic
949837861 3:8288762-8288784 ACCAGATAAAGAGGTCAACCAGG - Intergenic
950941031 3:16891657-16891679 CACAGCAAAAGATGTAAACCTGG - Intronic
957460961 3:80519956-80519978 CACAGCAAAAGAATTCAGCCTGG - Intergenic
959583191 3:108002645-108002667 CAGATCTAAAGAGGTGCTCCTGG - Intergenic
960685157 3:120287755-120287777 CACAGCTGAAGAGCTCAGGCAGG - Intergenic
966199540 3:177347765-177347787 CACTGTTAAAGAGGTAACCCTGG - Intergenic
966298895 3:178456295-178456317 CAGAACTAAATAGGTCCTCCAGG - Intronic
967225238 3:187284772-187284794 CACAGGTAAAGAAGTAACCCAGG - Intronic
969890860 4:10258817-10258839 CACAGCTTCAGAGGATATCCAGG - Intergenic
970361660 4:15315146-15315168 CAAGGCTAATGAGGTCAGCCTGG - Intergenic
973715814 4:53674765-53674787 CAAAGCTAAAGATCTTATCCTGG - Intronic
978599935 4:110417239-110417261 CACACCTGAAGAGTTCATACTGG + Intronic
979617881 4:122765039-122765061 CAATTCTAAAGAGGTAATCCTGG - Intergenic
984711851 4:182892440-182892462 GGCAGCTCATGAGGTCATCCTGG + Intronic
985120174 4:186631970-186631992 CACACCTTAACAGGTCAACCTGG + Intronic
993281710 5:85933473-85933495 CACAGCTAAAGGCTTCATCTTGG + Intergenic
994296807 5:98099608-98099630 CAAAGCAAAAGAGGTCATTGTGG - Intergenic
997905763 5:137815352-137815374 CACATGTAAACAGGTCTTCCTGG - Intergenic
1003126570 6:3360817-3360839 CACAGCTGGCGTGGTCATCCAGG + Intronic
1003163906 6:3659799-3659821 CATAGGCAAAGAGCTCATCCTGG - Intergenic
1005993989 6:30920841-30920863 CACAGCTGGAGAGGTCTTCAGGG - Intronic
1006582326 6:35084171-35084193 CAAAGGTACAGAGGTCCTCCGGG - Exonic
1010388113 6:75305734-75305756 CACAGCTACAGAGGAGACCCTGG - Intronic
1010864913 6:80963997-80964019 CAAAGCTAAACAAGTCATCAGGG + Intergenic
1011711794 6:90062405-90062427 TACAGCTAAAGAGGTCTTAGAGG + Intronic
1014906324 6:127033134-127033156 CACAGCCAAATAGGTCTGCCAGG - Intergenic
1016111200 6:140226757-140226779 CACAGTGAAAGAGGTAAACCTGG - Intergenic
1019513325 7:1429193-1429215 CAAAGCTAAACAGGGCTTCCGGG + Intronic
1020239632 7:6383565-6383587 CTCAGCTAAAGATGTCATTCAGG + Intronic
1024534494 7:50418763-50418785 CACAGCTTGAGAGGCCGTCCTGG + Intergenic
1026685764 7:72508645-72508667 CACACCTAACGAGGCCATCTAGG - Intergenic
1031274994 7:119709906-119709928 GGCAACTAAAGAGGTTATCCAGG + Intergenic
1034594531 7:152177199-152177221 CTGACCTTAAGAGGTCATCCAGG + Exonic
1035227152 7:157439918-157439940 GACAGCTAAGGAGGTACTCCTGG - Intergenic
1038368489 8:26962418-26962440 CAGAGCCAAAGTGGTCATGCTGG + Intergenic
1038619150 8:29123625-29123647 CACAGCTAGAGAGGTCAGATGGG + Intronic
1041049060 8:53915441-53915463 CAAAGCTGAAGAGGTCAGGCAGG - Intronic
1042477352 8:69263616-69263638 CACAGATAAAGAGGTGAGACTGG - Intergenic
1043093272 8:75931249-75931271 CACAGCTAAAGATTTCATGATGG + Intergenic
1050338929 9:4616443-4616465 CAAAGCACAGGAGGTCATCCTGG - Intronic
1051693981 9:19748720-19748742 CACAGCTAAAGACATCCTCCTGG + Intronic
1052336795 9:27328666-27328688 CACAGCTACAGAGTTCCTCCAGG + Exonic
1052414779 9:28164506-28164528 CACAGCTAGAAAGGTAATCCAGG + Intronic
1058953790 9:109927161-109927183 GACAGATAAAGAGGTCACCCAGG - Intronic
1190089042 X:47421537-47421559 CACAGCTAAAGAGGTCTACCTGG - Intergenic
1190627845 X:52353863-52353885 AACACCTACAGATGTCATCCAGG + Intergenic
1193256034 X:79350290-79350312 CACAACTAAAAAGATAATCCTGG - Intergenic
1193984826 X:88227935-88227957 CACATCTAGAAATGTCATCCAGG - Intergenic
1198028764 X:132734838-132734860 CACAGCTAAAGACGGTATCCAGG - Intronic